A Homozygous Dab1−// Is A Potential Novel Cause Of Autosomal Recessive Congenital Anomalies Of The Mice Kidney And Urinary Tract

Feb 28, 2022

edmund.chen@wecistanche.com

Introduction

Yotari mutant mice, obtained by spontaneous acquisition of a mutation in the Dab1 gene, exhibit histological abnormalities in the central nervous system [1,2], very similar to those of reeler (reelin//) mice, suggesting that reelin and DAB1 belong to the same signaling pathway [1–4]. The aberrations in the reelin/DAB1 pathway have been reported to be associated with various psychiatric disorders [5–7]. Interestingly, besides the central nervous system, the presence of DAB1 and reelin proteins has also been confirmed in the peripheral nervous system and some extraneural tissues. The presence of DAB1 has been found in mouse podocytes [8] and human fetal kidneys [9] while reelin expression has been reported during mouse and human fetal development, as well as in some endothelial cells along blood vessels in the adult mouse [9–11]. The canonical reelin/DAB1 pathway may trigger distinct downstream proteins, including NOTCH2 receptors, which play critical roles in cell-fate decisions and differentiation during kidney development [12–14]. NOTCH2 receptors are required to form proximal tubules and podocytes [13], but once nephron maturation is achieved, this pathway is mostly silenced [15]. In conditions of acute kidney diseases, increased expression of NOTCH2 may potentially contribute to regeneration, while sustained expression is causally associated with interstitial fifibrosis and glomerulosclerosis [15]. Downregulation of NOTCH signaling can greatly diminish autophagy and cause podocyte differentiation impairment during development [16].

Consequently, dysfunctional podocytes play a crucial role in glomerular disease, especially in human idiopathic nephrotic syndrome [17,18] and in minimal change nephrotic syndrome (MCNS) [19]. Hence, autophagy maintains cellular homeostasis under normal physiological conditions, whereas in pathological conditions, it can progress into autophagic death [20]. A widely used autophagy biomarker is LC3B, a structural protein of autophagosomal membranes [21]. Complex crosstalk between autophagy and apoptosis also contributes to the maintenance of homeostatic balance as a response to the cell’s microenvironment. It is well-known that apoptotic events increase in number during kidney development [22] and greatly diminish once maturation is over, except in conditions of renal injury [23]. Undeniably, apoptosis is a complex mechanism regulated through the interplay of several pathways but mostly fifinishes with activation of caspase3 (CASP3), whose activation is one of the most often used markers for apoptosis detection [23]. 

In this report, we aimed to analyze how Dab1 gene functional silencing inflfluences kidney morphology and the expression and localization of reelin, NOTCH2, LC3B, and cleaved CASP3 proteins in postnatal mice kidneys. We assume that these proteins are expressed in the postnatal mouse kidney, and their functional interplay contributes to the maintenance of their structure and function. In addition, as the presence of DAB1 has been confifirmed during fetal human kidney development [9], it could be presumed that its inactivation may cause disorder in a wide spectrum of congenital anomalies of the kidney and urinary tract (CAKUT). 

Keywords: yotari; kidney function; postnatal kidney development; immunoflfluorescence staining; transmission electron microscopy

cistanche-kidney function-6(60)

CISTANCHE WILL IMPROVE KIDNEY/RENAL FUNCTION

Materials and Methods

Sample Collection  As Dab1 null conventional mutants, we used yotari (Dab1/ ) mice previously describes by Howell et al. [24]. PCR primers used for genotyping of the mice were yotari: GCCCTTCAGCATCACCATGCT and CAGTGAGTACATATTGTGTGAGTTCC, wild-type of Dab1 locus: GCCCTTCAGCATCACCATGCT and CCTTGTTTCTTTGCTTTAA-GGCTGT [5]. C57BL/6 N mice were raised and group-housed in standard polycarbonate cages (including at least one of each genotype) with ad libitum access to food and water in a temperature controlled (23 ± 2 ◦C) room with a 12 h light/dark cycle. On postnatal days 4, 11 and 14 (P4, P11, and P14), mice were deeply anesthetized with pentobarbital and transcardially perfused for 10 min with phosphate buffer saline (PBS, pH 7.2) and 4% paraformaldehyde (PFA) in 0.1 M PBS. Kidneys were removed and fifixed with 4% PFA in 0.1 M PBS overnight for conventional histological analyses (hematoxylin–eosin (H&E), immunohistochemical and immunoflfluorescence staining) and in a 2% PFA + 2.5% glutaraldehyde (GA) mixture for electron microscope examination. After fifixation, tissue was prepared for further histological examination, as we have described previously [25,26]. 

Immunoflfluorescence and Immunoperoxidase Staining  After deparaffifinization and rehydration, sections were heated for 20 min in the 0.01 M citrate buffer (pH 6.0) in a water steamer and, afterward, cooled down to room temperature. Blocking buffer (ab 64226, Abcam, Cambridge, UK) was applied for 30 min to exclude unspecifific staining. Sections were then incubated in a humidity chamber overnight with primary antibodies (Table 1). After washing in PBS, secondary antibodies (Table 1) were applied for one hour and washed in PBS again. Then, nuclei were stained with 4060 -diamidino-2-phenylindole (DAPI) for 2 min, washed in PBS, and coverslipped. We performed the preadsorption test so that each primary antibody was used with the corresponding peptide and apply their combination to the sections. The results showed no antibody staining. In addition, controls with the omission of the primary antibody to determine levels of nonspecifific binding of secondary antibodies were performed. 

image

For immunoperoxidase staining, rabbit polyclonal anti-CASP3 (1:100 dilutions, ab13847, Abcam, Cambridge, UK) was applied as a primary antibody for one hour in a humidity chamber after the treatment of the section with 0.1% H2O2. After washing in PBS, secondary detection was performed using the link and streptavidin peroxidase, each for fififteen minutes (DakoCytomation, CA 93013 USA, LOT 03477) and diaminobenzidine (Dako, CA 93013 USA, LOT 10051369), carefully controlled to avoid background overstaining. Nuclei were stained with hematoxylin, rinsed in tap water for 10 min, brieflfly dehydrated in ascending series of ethanol solutions, and coverslipped. 

Tissue Preparation for Transmission Electron Microscope (TEM)  After fifixation with a mixture of 2% PFA and 2.5% GA in 0.1 M PBS for 2 h, the samples were washed with PBS and postfifixed in an aqueous solution of 2% osmium tetroxide for 2 h. All samples were washed twice in PBS, dehydrated in ascending grades of ethanol and embedded in Epon 812 (TAAB Laboratories Equipment, Reading, UK). Serial sections (70 nm in thickness) were cut on an Ultracut UCT ultramicrotome (Leica Microsystems, Wetzlar, Germany) and stained with 1% uranyl acetate and lead citrate. 

Data Acquisition and Analysis  The analysis was performed with an epiflfluorescence microscope (Olympus BX51, Tokyo, Japan) equipped with a DP71 digital camera (Olympus), a JEM 1400 transmission electron microscope (JEOL, Tokyo, Japan) operated at 80 kV and photographed with a JEOL charge-coupled device (CCD) camera system (Advanced Microscopy Techniques, Danvers, MA, USA) and lastly, a bright-fifield microscope (BX40, Olympus, Tokyo, Japan). All analyzed images were processed with ImageJ software and Adobe Photoshop (Adobe, San Jose, CA, USA). Per examined group, we used three to four animals. All collected kidneys were cut at 5 µm thick sections, and maximum kidney length determined by using these samples was reported. Mean proximal convoluted tubules (PCT), distal convoluted tubules (DCT) and glomeruli diameters were determined by averaging 100 structure diameters per analyzed sample. As nephron segments have irregular shapes, we took the largest diameter of every examined segment as representative. The staining intensity was semiquantitatively evaluated at four degrees: the absence of any reactivity (( ), mild reactivity (+), moderate reactivity (++), and strong reactivity (+++) (Table 2). The number of DAB1, reelin, NOTCH2, LC3B, and cleaved CASP3 immunoreactive cells was counted and expressed as a percentage of total cells. For each sample, we analyzed twenty PCT, DCT, and G at ×40 objective magnifification. We averaged the number of positive cells per group. Any level of nuclear, cytoplasmic, or membrane staining was regarded as positive. Three investigators analyzed the images independently. Interrater agreement was tested with interclass correlation analysis, which yielded a coeffificient >0.75, indicating excellent agreement [27]. 

image

Statistical Analysis  A two-tailed t-test was performed to analyze the differences in the average diameter between PCT, DCT and G of wild-type and yotari animals. The diameter was presented as mean ± standard deviation (SD). The level of signifificance was set at p < 0.05. A twoway ANOVA test followed by Tukey’s multiple comparison test was used to examine the differences in the percentage of positive cells between PCT, DCT, and glomeruli at all-time points. The percentage of positive cells was expressed as the mean ± standard error of the mean (SEM). The level of signifificance was set at p < 0.05. The analysis was performed in GraphPad software (GraphPad Software, La Jolla, CA, USA). 

Results

Hematoxylin-Eosin Staining (H&E) and Measurement of Kidney Diameter  H&E staining of midsagittal sections of the kidneys at all examined timepoints highlights the small kidney phenotype of yotari mice compared to wild-type (Figure 1a). At 4P mean kidney diameter of yotari animals was around 55 µm than around 75 µm. In addition, this difference was noticeable at later time points due to the slower growth of the kidneys in yotari compared to the progressive growth of the kidneys in wild-type animals. To determine whether the reduction in overall kidney size was caused by a decrease in nephron segment size, we averaged the diameter of PCT, DCT and G per group. Indeed, there was a decrease in mean diameter G, PCT and DCT in the yotari group compared to wild-type (Figure 1b, p < 0.05). Additionally, H&E staining revealed thinner cortex and renal pelvis extension in yotari animals and slightly diffusely dilated DCT at 14P. The basic structure and pattern of glomerular maturation are the same in both examined animal groups.

image

Descriptive Histological Analysis Based on TEM Microphotographs  On microphotographs obtained by TEM, glomeruli of wild-type mice showed the typical appearance of all parts of the fifiltration barrier, which were normally developed and recognizable (Figure 2a). Podocytes, podocyte foot processes and pedicles, fifiltration slits, glomerular basement membranes, and the capillary lumen with the fenestrated endothelium were easily distinguishable (Figure 2a). On the other hand, in the glomeruli of yotari mice, progressive podocyte damage with foot process effacement and lack of fifiltration slits could be observed (Figure 2b–d). These ultrastructural changes were observed in all kidneys examined and involved most of the examined glomeruli. No abnormalities were noticed in the PCT or DCT of yotari mice than wild-type animals (Figure 2e–h). In the PCT, cell interfaces were defifined poorly because of the irregularity of cell membranes and cell interdigitation with their neighbors. The cytoplasm was abundant, containing well-distinguished nuclei, elongated mitochondria, basal infoldings, and many tubular pits between microvilli, which formed a brush border at the apical membrane. Higher magnifification revealed the apical surface of PCT epithelial cells containing long microvilli to form the brush border and tight junctions between the luminal cell borders of neighboring tubular epithelial cells (Figure 2e,f). On the other hand, the apical surface of DCT epithelial cells contained few short microvilli and numerous vesicles (Figure 2g,h).

image

Figure 2. Transmission electron microscope (TEM) microphotographs of wild-type and yotari kidneys.Glomeruli of wild-type animals (a) showed a normally developed fifiltration barrier with fenestrated endothelium (E) of the capillary (C), basement membrane (BM), podocytes (P) with pedicles (PE), and fifiltration slits (FS). In the kidneys of yotari animals, effacement of the pedicles and lack of fifiltration slits could be noticed (asterisks, b–d). No abnormalities were noticed in the proximal convoluted tubules (PCT) or distal convoluted tubules (DCT) of yotari mice compared to the wild-type animals (e–h). In the PCT, the cytoplasm was abundant, containing well-distinguished nuclei (N), elongated mitochondria (M), basal infoldings (BI), and many tubular pits (TP) between microvilli, which formed a brush border (BB) at the apical membrane (e,f). Higher magnifification revealed the apical surface of PCT epithelial cells containing long microvilli to form the brush border and tight junctions (TJ) between the luminal cell borders of neighboring tubular epithelial cells (e,f). On the other hand, the apical surface of DCT epithelial cells containing few short microvilli and numerous vesicles (g,h). The scale bar in images (a–d) and insets (e–h) is 1 µm; the scale bar in images (e–h) is 2 µm.

Localization and Colocalization of Reelin and DAB1  Reelin was weakly expressed with mild to moderate reactivity (Table 2) in the glomeruli and DCT of all examined animals at all observed time points (p < 0.05, Figure 3a). Only in the PCT of yotari mice was the percentage of positive cells significantly higher than wild-type animals (p < 0.05, Figure 3a). In the glomerular cells, the localization of staining was perinuclear, while in the PCT and  DCT, it was scattered throughout the cytoplasm (Figure a,b).

image

image

image

image

igure 4. Immunofluorescence staining of postnatal yotari kidneys with reelin marker (a) and double immunofluorescence staining of postnatal wild-type kidneys with DAB1 and reelin markers  (b). (a,b) Nuclear DNA DAPI staining merged with DAB1, and reelin immunofluorescence is  shown in parallel (merge). Observed time points were P4, P11, P14. Expression of the examined  markers in the glomeruli (G), proximal convoluted tubules (PCT) and distal convoluted tubules  (DCT) is marked with the arrows, while asterisks are indicating expression of the reelin in the extracellular matrix (a). Inserts show the most prominent expression in the image. DAPI nuclear  staining revealed poor colocalization of DAB1 and reelin, mostly in the DCT (arrowhead). Scale  bar is 20 µm and refers to all images. 

There was almost no immune reactivity of DAB1 in glomeruli and PCT of wild-type  animals at P4, while the percentage of positive cells with mild reactivity (Table 2) significantly increased at P11 and P14 (p < 0.05, Figure 3b). In the DCT, DAB1 was expressed  mostly at the apical and lateral parts of cell membranes (Figure 4b) with strong reactivity  (Table 2). The percentage of positive cells was significantly higher than in previous structures, around 60% (Figure 3b), especially in the macula densa (Figure 4b).  There was almost no colocalization of the DAB1 and reelin except in the DCT of wildtype animals at P14 (arrowhead, Figure 4b).  Biomolecules 2021, 11, 609 8 of 14 Figure 4. Immunoflfluorescence staining of postnatal yotari kidneys with reelin marker (a) and double immunoflfluorescence staining of postnatal wild-type kidneys with DAB1 and reelin markers (b). (a,b) Nuclear DNA DAPI staining merged with DAB1, and reelin immunoflfluorescence is shown in parallel (merge). Observed time points were P4, P11, P14. Expression of the examined markers in the glomeruli (G), proximal convoluted tubules (PCT) and distal convoluted tubules (DCT) is marked with the arrows, while asterisks are indicating expression of the reelin in the extracellular matrix (a). Inserts show the most prominent expression in the image. DAPI nuclear staining revealed poor colocalization of DAB1 and reelin, mostly in the DCT (arrowhead). Scale bar is 20 µm and refers to all images. There was almost no immune reactivity of DAB1 in glomeruli and PCT of wild-type animals at P4, while the percentage of positive cells with mild reactivity (Table 2) significantly increased at P11 and P14 (p < 0.05, Figure 3b). In the DCT, DAB1 was expressed mostly at the apical and lateral parts of cell membranes (Figure 4b) with strong reactivity (Table 2). The percentage of positive cells was signifificantly higher than in previous structures, around 60% (Figure 3b), especially in the macula densa (Figure 4b). There was almost no colocalization of the DAB1 and reelin except in the DCT of wild-type animals at P14 (arrowhead, Figure 4b)

Spatial and Temporal Expression Patterns of NOTCH2 and LC3B  The percentage of NOTCH2-positive cells was less than 20% in the glomeruli of both  animal genotypes at all observed time points. Only at P14 percentage of positive cells was significantly higher in the glomeruli of yotari animals than wild-type animals (p < 0.05,  Figure 3c). The staining intensity was mild to moderate (Table 2), mostly located perinuclearly (Figure 5a–f). In the PCT and DCT of both animal genotypes percentage of positive cells increased through time. At P14, the percentage of positive cells was significantly  higher in PCT and DCT of yotari animals than PCT and DCT of wild-type animals (p <  0.05, Figure 3c). Signal intensity at all observed time points was mild to moderate (Table  2) and scattered throughout the cytoplasm (Figure 5a–f).  Figure 5. Immunofluorescence staining of postnatal wild-type and yotari kidneys with NOTCH2  and LC3B markers and immunoperoxidase staining with cleaved caspase3 (CASP3) marker. (a–f)  Nuclear DNA DAPI staining is merged with NOTCH2 and LC3B. Observed time points were P4,  P11, P14. Expression of the NOTCH2 and LC3B markers in the glomeruli (G), proximal convoluted tubules (PCT) and distal convoluted tubules (DCT) is marked with the arrows. Especially  strong LC3B reactivity can be observed in the Bowman capsule of decaying glomeruli (asterisk, e).  Inserts show the most prominent expression in the image. CASP3 was poorly expressed in all observed time points. The only significant expression was in the glomeruli of yotari mice on P14 (arrows). Scale bar is 20 µm and refers to all images.  Biomolecules 2021, 11, 609 9 of 14 3.4. Spatial and Temporal Expression Patterns of NOTCH2 and LC3B The percentage of NOTCH2-positive cells was less than 20% in the glomeruli of both animal genotypes at all observed time points. Only at P14 percentage of positive cells was signifificantly higher in the glomeruli of yotari animals than wild-type animals (p < 0.05, Figure 3c). The staining intensity was mild to moderate (Table 2), mostly located perinuclearly (Figure 5a–f). In the PCT and DCT of both animal genotypes percentage of positive cells increased through time. At P14, the percentage of positive cells was signifificantly higher in PCT and DCT of yotari animals than PCT and DCT of wild-type animals (p < 0.05, Figure 3c). Signal intensity at all observed time points was mild to moderate (Table 2) and scattered throughout the cytoplasm (Figure 5a–f).

image

Figure 5. Immunoflfluorescence staining of postnatal wild-type and yotari kidneys with NOTCH2 and LC3B markers and immunoperoxidase staining with cleaved caspase3 (CASP3) marker. (a–f) Nuclear DNA DAPI staining is merged with NOTCH2 and LC3B. Observed time points were P4, P11, P14. Expression of the NOTCH2 and LC3B markers in the glomeruli (G), proximal convoluted tubules (PCT) and distal convoluted tubules (DCT) is marked with the arrows. Especially strong LC3B reactivity can be observed in the Bowman capsule of decaying glomeruli (asterisk, e). Inserts show the most prominent expression in the image. CASP3 was poorly expressed in all observed time points. The only signifificant expression was in the glomeruli of yotari mice on P14 (arrows). Scale bar is 20 µm and refers to all images.

In the glomeruli and DCT of both animal genotypes, the percentage of LC3B-positive cells increased through time (p < 0.05, Figure 3d). At P11 and P14, the percentage of positive cells was signifificantly higher in the glomeruli of yotari animals than the glomeruli of wild-type animals (p < 0.05, Figure 3d). In the glomeruli of yotari animals staining intensity was mostly moderate to strong (Table 2) located in the perinuclear and nuclear space (Figure 5a–f), at all observed time points, while in the glomeruli of wild-type mice, the intensity was mostly moderate (Table 2). PCT of yotari and wild-type animals contained around 20% of positive cells at all observed time points (p < 0.05, Figure 3d). 

Cleaved CASP-3 Expression  There was almost no expression of the activated CASP-3 in the kidneys of wild-type animals at all observed time points. In the PCT and DCT of yotari mice, several individual cells were CASP-3-positive (Figure 3e). Only in the glomeruli of yotari kidneys at P14 (Figure 5e), the percentage of positive cells signifificantly increased compared to kidneys of wild-type mice (p < 0.05, Figure 3e). 

Discussion

Kidney morphogenesis and development are complex processes precisely coordinated through the interplay of a large number of genes. Congenital anomalies of the kidney and urinary tract (CAKUT) are the most common birth defect that constitutes 23% of all such defects and represents the leading cause of end-stage renal disease in children [28,29]. Single gene disorders may be the primary source of CAKUT, and until now, a mutation in more than 20 genes has been identifified as the cause of CAKUT [30]. As our previous work showed great expression of DAB1 during normal fetal human kidney development [9], we assumed that DAB1 might play a signifificant role during mammalian kidney development. To prove our hypothesis, we investigated the kidney morphology and expression patterns of reelin, NOTCH2, LC3B, and activated CASP3 proteins in Dab1 knockout mice.

cistanche-kidney pain-3(27)

CISTANCHE WILL IMPROVE KIDNEY/RENAL PAIN

Sectioning through the yotari mice kidneys revealed a thinner cortex and a signifificantly smaller mean kidney and PCT, DCT and G diameters compared to wild-type animals. The decrease in kidney size caused by insuffificient nephron endowment is known as renal hypoplasia, one of the most common CAKUT disorders, which predisposes adult-onset hypertension and chronic kidney disease [31]. In addition, the microphotographs captured with the TEM revealed that yotari mice exhibited prominent podocyte damage with foot process effacement and a lack of fifiltration slits. After the injury, podocytes undergo the process of effacement in which they lose their structure, leading to a reduction in their fifiltration barrier function [32]. All forms of nephrotic syndrome, as well as focal segmental glomerulosclerosis (FSGS), are characterized by defects in podocyte structure or function [33]. 

Our current study showed the highest expression of DAB1 at the apical and lateral parts of cell membranes of the DCT, while REELIN was mostly scattered throughout the cytoplasm of the PCT. At the investigated time points, no morphological changes were observed in tubuli of yotari mice, but further investigation is necessary to elucidate the role of DAB1 in tubulointerstitial compartments. There was an occasional colocalization of the DAB1 and REELIN proteins, mostly in the DCT. These fifindings are following our previous work concerning the expression of these two proteins during fetal human kidney development [9]. This may suggest that DAB1 and reelin have similar roles in human and mouse kidneys by activating some of the downstream pathways, such as Crk, MAPK and PI3K/Akt/mTOR signaling cascades [34–36]. Our data also revealed increased reelin expression in the glomeruli of yotari mice. Interestingly, a previous study has shown that DAB1 phosphorylation and increased reelin expression in the glomeruli are accompanied by hypertension, proteinuria, and podocyte injury in the Ang II-infused rats [10].

In addition, immunofluorescence staining revealed an increased expression of NOTCH2 receptors in the glomeruli of P14 yotari mice. It is well-known that NOTCH2 expression is downregulated once nephron maturation is achieved, except in the conditions of renal injuries, such as diabetic nephropathy and FSGS [15,37]. Mice with the Adriamycin-induced nephrotic syndrome also showed increased expression of activated NOTCH2, which ameliorates fifibrosis [38]. At the investigated time points, we did not notice increased fifibrosis, but it remains to elucidate the exact role of the expressed NOTCH2 in the postnatal yotari kidneys. Further observation into whether fifibrotic changes occur in the later stages would be necessary. However, there are already some fifindings that suggest the short-term effect of increased NOTCH2 activation is associated with a strong survival benefifit for injured podocytes, which is lost in long-term models, such as diabetic nephropathy [39].

Higher LC3B expression in the glomeruli of P11 and P14 yotari mice probably re- flflected an accumulation of the autophagosomes in the podocytes. To clearly show that autophagy was accelerated. It is necessary to analyze the ratio of LC3-II and LC3-I protein expressions. Under normal conditions, autophagy is necessary for normal kidney function [40], especially in podocytes. Because of its limited capacity for cell division and replacement, they exhibit a high basal level of autophagy [41]. Despite these fifindings, elevation in LC3B expression has been reported in several glomerular diseases [42–44], mainly in association with foot process effacement and nephrotic syndrome development, as seen in prorenin receptor conditional knockout mice [45,46]. All these studies suggest a protective role of enhanced autophagy in pathological conditions, further supported by the fifindings of Adriamycin-induced nephropathy, where autophagy is activated to protect against podocyte injury [43], as well as in age-dependent glomerular disease where it delays the progressive functional decline of the kidney function [40]. Analysis of human kidney biopsies also showed evidence of increased autophagy in association with foot process effacement in several glomerular diseases, including minimal change nephrotic syndrome (MCNS), which is one of the most common causes of idiopathic nephrotic syndrome [19]. In the conditions of diabetic nephropathy and lipopolysaccharide-induced acute kidney injury, enhancing autophagy with some therapeutics through inhibition of the PI3K/AKT/mTOR pathway ameliorates kidney function [47,48]. All these fifindings implicate that autophagy has an indispensable cytoprotective role for stress adaption in kidney injury, and its modulation might be a promising therapeutic strategy, although, under some circumstances, autophagy can also be deleterious and progress into cell death.

cistanche-kidney failure-3(45)

CISTANCHE WILL IMPROVE KIDNEY/RENAL FAILURE

Except for the elevation in autophagy, an increased level of apoptosis could also be observed in the glomeruli of P14 yotari mice. Autophagy usually prevents apoptosis, but under specifific pathological circumstances, it can also have an opposite effect on cell survival by enhancing and promoting apoptosis [42]. After birth, apoptosis in the kidneys is greatly diminished, except in the conditions of kidney injury, such as idiopathic nephrotic syndrome where contributes to developing the disease [23]. potential novel cause of autosomal recessive congenital anomalies of the kidney and urinary tract. However, the main role of DAB1 during kidney development remains unclear. In addition, these mice displayed foot process abnormalities and an increased level of reelin, NOTCH2, LC3B and cleaved CASP3 proteins in the glomeruli that may lead to glomerular injuries, like nephrotic syndrome, which in correlation with hypoplasia, may be a potential cause of death of these animals during the weaning period. To confifirm this hypothesis, it is necessary to provide additional information concerning blood pressure and other clinic-laboratory parameters, such as levels of serum creatinine, albumin, and proteins.

You Might Also Like