The Inhibitory Effect Of Curcumin Derivative J147 On Melanogenesis And Melanosome Transport By Facilitating ERK-Mediated MITF Degradation Part 1

The therapeutic use of curcumin and chemically modified curcumin (CMC) for suppressing melanogenesis and tyrosinase activity have been recognized. J147 is a modified version of curcumin with superior bioavailability and stability. However, there is no report about the effects of J147 on pigmentation in vitro and in vivo. In our studies, we investigated the hypo pigmentary effects of J147 treatment on melanocytes and explored the underlying mechanism. The present studies suggested that J147 suppressed both basal and α-MSH-induced melanogenesis, as well as decreased melanocyte dendrite extension and melanosome transport. J147 played these roles mainly by activating the extracellular signal-regulated protein kinase (ERK) pathway. Once activated, it resulted in MITF degradation and further down-regulated the expression of tyrosinase, TRP-1, TRP-2, Myosin Va, Rab27a, and Cdc42, ultimately inhibiting melanin synthesis and melanosome transport. Furthermore, the hypo pigmentary effects of J147 were demonstrated in vivo in a zebrafish model and UVB-induced hyperpigmentation model in brown guinea pigs. Our findings also suggested that J147 exhibited no cytotoxicity in vitro and in vivo. Taken together, these data confirmed that J147 may prove quite useful as a safer natural skin-whitening agent.

Cistanche also has the function of promoting collagen production, which can increase the elasticity and luster of the skin and help repair damaged skin cells. Cistanche Phenylethanol Glycosides have a significant down-regulating effect on tyrosinase activity, and the effect on tyrosinase is shown to be competitive and reversible inhibition, which can provide a scientific basis for developing and utilizing the whitening ingredients in Cistanche. Therefore, cistanche has a key role in skin whitening. It can inhibit melanin production to reduce discoloration and dullness; and promote collagen production to improve skin elasticity and radiance. Due to the widespread recognition of these effects of cistanche, many skin whitening products have begun to infuse herbal ingredients such as Cistanche to meet consumer demand, thus increasing the commercial value of Cistanche in skin whitening products. In summary, the role of cistanche in skin whitening is crucial. Its antioxidant effect and collagen-producing effect can reduce discoloration and dullness, improve skin elasticity and luster, and thus achieve a whitening effect. Also, the wide application of Cistanche in skin whitening products demonstrates that its role in commercial value cannot be underestimated.

Keywords: J147, hypo pigmentary effects, melanosome transport, ERK pathway, MITF degradation

Click on Cistanche Tubulosa for Whitening

For more info: david.deng@wecistanche.com  WhatApp:86 13632399501

INTRODUCTION

Skin pigmentation depends on both melanin synthesis and distribution in the epidermis layer. Melanin is produced mainly around the nucleus of melanocytes and stored in melanosomes (Tian et al., 2021). After maturing, melanosomes migrated along microtubules and actin filaments to the dendrite tips of the cells and finally to the neighboring keratinocytes to finish the distribution process (Beaumont et al., 2011; Ohbayashi and Fukuda, 2012). Under normal physiological status, melanin protects human skin from ultraviolet (UV) damage, toxic chemicals, and other environmental factors (Slominski et al., 2004; Yousaf et al., 2020). However, excessive production and accumulation induce hyperpigmentation and are associated with skin disorders like post-inflammatory melanoderma, melasma, and solar lentigines, leading to a remarkable psychosocial burden (Pillaiyar et al., 2017). Hence, it is necessary to develop effective and safe skin whitening agents.

In recent years, melanin cell biology has become a broader research field and several important proteins contributing to melanogenesis and melanosome transport have been elucidated, paying the way for identifying melanin synthesis inhibitors. Tyrosinase is exclusively necessary for melanogenesis and inhibition of tyrosinase catalytic action is the most common method to reduce melanin production (D’Mello et al., 2016). Several known tyrosinase inhibitors, including arbutin and kojic acid, have already been developed as cosmetic additives (Ding et al., 2020). KIF5b and Rab27A-Melanophilin-Myosin Va complex contribute to the outward melanosome transport (Ohbayashi and Fukuda, 2012; Noguchi et al., 2014). Cdc42 regulates dendrite elongation, which is essential for melanosome transfer (Luo, 2000). The inhibition of these above proteins could significantly suppress melanosome transport, which is an important mechanism for developing skin whitening agents. Microphthalmia-associated transcription factor (MITF) is a master transcription factor in melanogenesis. Besides, MITF also regulates melanosome transport by inducing the expression of Rab27a and Cdc42 (Noguchi et al., 2016). Multiple signaling pathways participate in pigmentation by regulating the expression level of MITF. Activation of cAMP protein kinase A (PKA) stimulates pigmentation through cAMP response element binding protein (CREB) dependent upregulation of MITF expression (Rodríguez and Setaluri, 2014). Conversely, activation of extracellular signal-regulated protein kinase (ERK) inhibits melanogenesis by accelerating MITF degradation (Lv et al., 2020a). Numerous anti-melanogenic agents have been developed that target tyrosinase activity, melanosome transfer, or melanogenic-related signaling pathways. However, few inhibitors underwent studies in vivo and showed good results (Pillaiyar et al., 2017).

Curcumin is a diarylheptanoid compound isolated from the rhizome of Curcuma longa (Zingiberaceae) and used as a yellow flavor or pigment in foods (Zheng J. et al., 2018). Studies have indicated its various physiological functions, including anti-inflammatory, anti-oxidative, anti-amyloid, and anti-tumor activities (Liu et al., 2016; Zheng Y. et al., 2018). Apart from these, curcumin inhibits tyrosinase activity and suppresses melanogenesis in melanocytes (Lee et al., 2010; Tu et al., 2012). But, the poor bioavailability of curcumin limits its application (Karthikeyan et al., 2020). To solve this problem, J147 is developed as a potent compound of curcumin derivative with greater stability and bioavailability (Li et al., 2020). J147 has a neuroprotective effect and is currently in phase I clinical trials for Alzheimer’s disease. However, there is still no report about the effects of J147 on pigmentation in vitro and in vivo.

MATERIALS AND METHODS

Reagents

J147 (J302241), α-MSH (M118985), and tyrosinase from mushroom (T128536) were obtained from Aladdin (Shanghai, China). We obtained antibodies against Myosin Va (sc-365986), KIF5b (sc-133184), GP100 (sc-393094), Cdc42 (sc-8401), Rab27a (sc-74586), p-JNK (sc-6254), JNK (sc-7345), p-p38 MAPK (sc-166182) and p38 MAPK (sc-398546) from Santa Cruz (CA, USA). The antibodies against MITF (97800), p-MEK (2338), MEK (4694), p-ERK (4370), and ERK (4695) were obtained from Cell Signaling Technology (MA, USA). The antibodies against tyrosinase (ab180753), TRP-1 (ab235447), TRP-2 (ab221144), cytokeratin (ab7753), and S100 (ab133519) were obtained from Abcam (Cambridge, UK). p38 inhibitor SB203580 (S1863), ERK inhibitor PD98059 (S1805), BCA protein assay kit (P0012), cell lysis buffer (P0013), and β-actin (AF5001) were obtained from Beyotime (Shanghai, China). RT-qPCR kits (RR036A) were purchased from Takara Biomedical Technology (Beijing, China).

Cell Culture

MTT Assay

Cell viability was examined by MTT assay (Yun et al., 2020). Briefly, the cells were seeded in 96-well plates and treated with J147 (1–8 μM) for 48 h. Then, the cells were washed with PBS and replaced with MTT solution (20 μL). After incubation for an additional 4 h, the supernatant solution was removed and DMSO (200 μL) was added to each well. Finally, the optical absorbance at 570 nm was determined.

Measurement of Melanin Contents

Cells with a density of 2 × 105 cells/mL were seeded in 6-well culture plates. After 24 h incubation, cells were cultured with different doses of J147 (1, 2, 4 μM) and with or without α-MSH (60 nM) stimulation. After 48 h treatment, cells were harvested and the total melanin in the cell pellet was dissolved in 100 μL of NaOH working solution (1 mol/L, 10% DMSO) at 80° C for 1 h, and the absorbance was measured at 405 nm (Lv et al., 2015; Lv et al., 2019).

Tyrosinase Activity Assay

Cellular tyrosinase activity was examined as described previously (Liao et al., 2017; Lv et al., 2020a). In brief, cells were lysed by cell lysis buffer after washing three times, and then the supernatant for tyrosinase activity assay was obtained by centrifuging the lysates. 100 μL PBS (0.1M, pH 6.5) contenting 10 μg proteins mixed with 100 μL 0.1% L-DOPA. The plate was incubated at 37°C for 1 h, and then optical absorbance at 475 nm was monitored.

The direct effect of J147 on tyrosinase activity was tested by a cell-free system as described previously (Lv et al., 2020a). In brief, the reaction for the determination of mushroom tyrosinase activity was conducted in a 96-well plate and the reaction mixture contained mushroom tyrosinase (10 unit), L-tyrosine (0.03%, 50 μL), and 100 μL PBS (0.1 M, pH 6.5) adding with different concentrations of J147. Following incubation at 37°C for 10 min, absorbance at 475 nm was measured using a microplate spectrophotometer.

Masson–Fontana Ammoniacal Silver Staining

To detect melanin pigment, skin pieces, and melanocytes were fixed in formalin and stained following the standard protocol (Gu et al., 2018; Lv et al., 2020b). In brief, slides were washed 3 times with deionized water and then were incubated in ammoniacal silver solution at room temperature for 12 h. After rinsing well in deionized water, slides were incubated in hypo solution for 5 min. Next, slides were rinsed again and counterstained with a neutral red stain for another 5 min. Finally, following thorough rinsing, slides were observed under a Nikon-Eclipse-Ti microscope.

Immunofluorescence for Melanosome Transfer

The coculture system of B16F10 and HaCaT cells was established on the confocal dish, as described previously (Lee et al., 2015; Lv et al., 2020c). After the J147 treatment, the cells were immunostained with anti-GP100 and anti-Cytokeratin according to the standard protocol. Images were taken from the Nikon-Eclipse-Ti microscope.

Immunohistochemistry for S-100

Immunohistochemistry for S-100 was performed as previously described (Lee et al., 2013; Lv et al., 2020b). A brief description was as follows: slides were blocked with 5% BSA at 25° C for 1 h and then incubated with anti-S-100 primary antibody at 4° C overnight. The next day, slides were washed 3 times with TBST solution and incubated with the secondary antibody. Then, slides were treated with aminoethyl carbazole to develop the sections and were observed under a microscope.

Reverse Transcription–PCR

Cellular total RNA was extracted by TRIzol reagent and quantified spectrophotometrically. Then, SuperScript II Reverse Transcriptase was used to synthesize single-stranded cDNA following the manufacturing instructions. Oligonucleotide primers were purchased from GenScript (Nanjing, China). The sequences of MITF gene primers are 5′- AGAGCAGGGCAGAGAGTGAGTG -3′, 5′-AACTTGATT CCAGGCTGATGATGTC -3′. The sequences of GAPDH gene primers are 5′- AGGTCGGTGTGAACGGATTTG-3′, 5′- TGT AGACCATGTAGTTGAGGTCA -3′. PCR products were separated by electrophoresis on 1% agarose gels and detected under ultraviolet light (Lee et al., 2013).

Western Blotting

Proteins (40 μg) were separated by SDS-PAGE gels and transferred to nitrocellulose filter (NC) membranes by an electrophoretic transfer system (Bio-Rad). NC membranes were blocked with 3% BSA in TBST solution at room temperature for 1.5 h. Then membranes were incubated with primary antibodies at 4°C overnight. The next day, the blots were washed 3 times with TBST solution and then incubated with peroxidase-conjugated secondary antibodies at 25°C for 1 h, and visualized by using enhanced chemiluminescence (Lv et al., 2020d).

Determination of Melanin Content in Zebrafish Model

Briefly, synchronized embryos were collected and arrayed by pipette (three to four embryos per well with 200 μL embryo medium in 96-well plates). Then, J147 and PTU were dissolved in 0.1% DMSO and were added to the embryo medium from 35 to 60 h (25 h exposure). The influence of J147 on the melanogenesis of zebrafish was observed under the stereomicroscope (Zheng J. et al., 2018).

Phenotype-Based Evaluation and UVB-Induced Hyperpigmentation Guinea Pig Model

8 brown guinea pigs (6 weeks, approximately 250–300 g) were purchased from the Institute of Laboratory Animal Science (Beijing, China). These guinea pigs were kept alone in a constant temperature and humidity room under a 12-h light/ dark cycle. The separate areas (1 cm diametrical circle) of the back of each animal were exposed to 500 mJ/cm2 UVB (Sigma SH-4, Shanghai, China) once a day for 1 week to establish the hyperpigmentation model. Then the vehicle (PEG400/EtOH=7:3) and J147 (1%) were given to the hyperpigmented areas (20 μL solution per circle) twice a day for 3 weeks. The degree of pigmentation was evaluated by calculating the ΔL-value according to the L-value measured by the spectrophotometer (YS3010, 3nh, Shenzhen, China), as follows: ΔL = L (at each day measured)-L (at day 0) (Lee et al., 2013; Lv et al., 2020b). All animal procedures in this study were approved by the animal care and use committee of Changzhou University.

Statistical Analysis

RESULTS

J147 Decreased Melanogenesis and the Number of Dendrites Within B16F10 Cells

The structure of J147 is shown in Figure 1A. Firstly, a cell viability experiment was performed to investigate if J147 was cytotoxic to B16F10 cells. As shown in Figure 1B, no cytotoxic effects of J147 were observed at a dosing range of 1–8 μM after 48 h. Then, we examined the influence of J147 on melanin synthesis. As shown in Figure 1C, J147 inhibited basal melanin synthesis. α-MSH significantly promotes melanogenesis in melanocytes. The increase in melanogenesis induced by α-MSH was reversed after J147 treatment. Consistently, Masson–Fontana ammoniacal silver staining showed that J147 remarkably reduced the melanin contents in B16F10 cells with or without α-MSH (Figure 1D). In addition, the number and length of dendrites and the melanin concentration in dendrites were also decreased when compared with untreated cells (Figure 1D). The results suggested that J147 decreased melanogenesis and dendrite formation without cytotoxic effects.

J147 Inhibited the Cellular Tyrosinase Activity and the Expression of Tyrosinase, TRP-1, TRP-2

The tyrosinase family of proteins (tyrosinase, TRP-1, and TRP-2) participated in melanogenesis. Among these, tyrosinases are key enzymes regulating the melanin biosynthetic pathway (D’Mello et al., 2016). To determine whether J147 influences tyrosinase activity, we first used the L-DOPA oxidation method to determine the effects of J147 on cellular tyrosinase activity. J147 (1–4 μM) was shown to exert profound inhibitory effects on cellular tyrosinase activity in a dose-dependent manner in B16F10 cells (Figure 2A). Next, a mushroom tyrosinase activity assay was performed to determine the direct effects of J147 on tyrosinase activity. As shown in Figure 2B, no inhibitory effects were observed, indicating that J147 did not influence the enzymatic activities of mushroom tyrosinase (Figure 2B). As we know, melanogenesis is controlled by the activity and amounts of those tyrosinases. To investigate if the anti-melanogenic effects of J147 are correlated with the expression of tyrosinase, westernblot analysis was conducted. As shown in Figure 2C, the levels of tyrosinase expression were significantly reduced after J147 treatment with or without α-MSH, and the same results were observed in the TRP-1 and TRP-2 expression. These observations indicated that J147 inhibited cellular tyrosinase activity and melanogenesis by reducing the expression levels of tyrosinase, TRP-1, and TRP-2.

J147 Inhibited Melanosome Transport by Regulating the Expression of Myosin Va, Rab27a and Cdc42

Human skin pigmentation is determined by melanin synthesis as well as the distribution of melanin. In mammalian melanocytes, melanin is mainly made in the cell body and migrates along actin filaments and microtubules to dendrites, and finally to the neighboring keratinocytes to finish the distribution process (Ohbayashi and Fukuda, 2012). As is shown in Figure 1D, J147 markedly decreased the dendrite formation. Furthermore, the melanin concentration in dendrites was also reduced as the melanin pigment was aggregated in the perinuclear regions. Next, we co-cultured B16F10 and HaCaT cells to investigate if J147 influences melanosome transfer to keratinocytes by confocal microscopy. The distribution of melanin was seen in the HaCaT cells in the co-culture model (Figure 3A). In contrast, while the co-culture model was treated with J147 for 48 h, melanosome granular signals in HaCaT cells were significantly reduced (Figure 3A).

To further clarify the underlying mechanism of the inhibition effects of melanosome transfer by J147, we examined several crucial factors involved in melanosome transport. KIF5b mediates outward melanosome transport along microtubules, and the Rab27aMelanophilin-Myosin Va complex contributes to melanosome transport along actin filaments in melanocytes (Reiner et al., 2020). In addition, Cdc42 stimulates dendrites formation in melanocytes, which also plays an essential role in melanosome transport. As shown in Figure 3B, the expression of Cdc42, Myosin Va, and Rab27a, but not KIF5b was significantly decreased after J147 treatment in the condition of with or without α-MSH. Our findings indicated that J147 inhibited melanosome transport by decreasing the expression of Myosin Va, Rab27a, and Cdc42.

J147 Accelerated MITF Degradation

MITF is one of the key regulators for melanogenesis and it controls the gene transcription of tyrosinase, TRP-1, TRP-2, Cdc42, and Rab27a (Noguchi et al., 2016; Kim et al., 2019). We first examined the influence of J147 on MITF transcripts. As shown in Figure 4A, α-MSH remarkably increased MITF transcription, however, no change was observed after J147 treatment, indicating that J147 does not downregulate MITF expression. Next, we examined if J147 influences the translation of MITF. As shown in Figure 4B, after α-MSH treatment, MITF protein levels increased, peaked at 4 h, and began to decline at 8 h (Figure 4B). Differently, the protein levels of MITF did not decrease at 4 h after J147 treatment, but at 8 h the MITF protein levels rapidly declined to undetectable levels, indicating that J147 does not influence the translation of MITF but remarkedly accelerates MITF protein degradation.

J147 Suppressed Melanogenesis Through the MEK/ERK Signaling Pathway

Mitogen-activated protein kinases (MAPK) signaling pathway, including extracellular signal-regulated protein kinase (ERK), p38, and c-jun N-terminal kinase (JNK), play crucial roles in pigmentation (Lee et al., 2013). ERK phosphorylation is known to facilitate the degradation of MITF and eventually dissipate the melanogenic stimuli, which represents a major negative feedback mechanism (Kwon et al., 2017). However, the function of the p38 and the JNK pathway remains controversial. Hence, we examined the effect of J147 on the MAPK signaling pathways. As shown in Figure 5A, J147 activated MEK/ERK and p38, whereas no influence was found in the phosphorylation of the JNK signaling pathway.

For more info: david.deng@wecistanche.com  WhatApp:86 13632399501