MiR‑214 Ameliorates Sepsis‑induced Acute Kidney Injury Via PTEN/AKT/mTOR‑regulated Autophagy

Feb 28, 2022

edmund.chen@wecistanche.com

Abstract.  Previous studies have suggested that oxidative stress and autophagy results in acute kidney injury (AKI) during sepsis and microRNA (miR)‑214 serves a vital role in the protection of kidneys subjected to oxidative stress. The present study aimed to test whether the renoprotection of miR‑214 is related to autophagy in sepsis. The role of autophagy was investigated in a mouse model of cecal ligation and puncture (CLP). Reverse transcription‑quantitative polymerase chain reaction(RT‑qPCR) was used to analyze the expression of miR‑214. The structure and function of kidneys harvested from the mice were evaluated. Kidney autophagy levels were detected with immunohistochemical, immunofluorescent and western blotting. It was found that miR‑214 could alleviate AKI in septic mice by inhibiting the level of kidney autophagy. Furthermore, miR‑214 inhibited autophagy by silencing PTEN expression in the kidney tissues of septic mice. These fifindings indicated that miR‑214 ameliorated CLP‑induced AKI by reducing oxidative stress and inhibiting autophagy through the regulation of the PTEN/AKT/mTOR pathway.

Keywords: microRNA‑214, sepsis, acute kidney injury, autophagy, renal

Introduction  Acute kidney injury (AKI) is one of the most common complications of sepsis and occurs in 40‑50% of septic patients, with a mortality rate of as high as 60% (1). However, the pathogenesis of sepsis‑induced AKI remains unclear. Autophagy has been reported to serve a key role in sepsis‑induced AKI and the inhibition of autophagy results in the development of AKI during sepsis (2,3). Previous studies (4,5) have confirmed that sepsis triggers autophagy in multiple organs, including the kidney (6) and autophagic processes are involved in the removal of damaged mitochondria and oxidative stress (7). However, excessive autophagy can cause unwanted and deleterious cell death (8). Therefore, a moderate level of autophagy is the key to reducing sepsis‑induced AKI. Previous studies have reported that miR‑214 ameliorates ischemia‑reperfusion‑induced AKI by inhibiting apoptosis (9) and miR‑214 suppresses oxidative stress in diabetic nephropathy via the reactive oxygen species (ROS)/AKT/mTOR signaling pathway (10). The present study found that miR‑214 can attenuate sepsis‑induced myocardial dysfunction in mice by inhibiting autophagy (11). However, whether miR‑214 can ameliorate sepsis‑induced AKI remains to be elucidated. In present study, it was hypothesized that miR‑214 attenuates CLP‑induced AKI by reducing oxidative stress and inhibiting autophagy through the regulation of the PTEN/AKT/mTOR pathway.

cistanche-kidney disease-4(52)

CISTANCHE WILL IMPROVE KIDNEY/RENAL DISEASE

Materials and methods 

Animals. A total of 100 Kunming male mice (weight, 20.40±2.92 g; age, 6‑8 weeks) supplied by the Medical Laboratory Animal Centre of the Hebei Medical University (Shijiazhuang, China) were used in the present study. All mice were acclimated to a 12‑h light/dark cycle at 24˚C with 50% humidity and were given free access to food and water at ≥1 week before the experiments. All the experimental procedures were performed in strict accordance with the National Institute of Health guidelines (NIH Publication No 85‑23, revised 1996) and approval by the Institutional Animal Care and Use Committees of the Cangzhou Central Hospital (approval no. 2017‑020‑01). All surgeries were performed under anesthesia and every effort was made to minimize suffering.

Cecal ligation and puncture (CLP). CLP was performed on mice to create a murine sepsis model, as previously described (12). Following anesthetizing by isoflurane inhalation (induced at 3% and maintained at 0.5%), a 1 cm midline incision was cut. The exposed cecum (1 cm distance from the end) was ligated with two punctures using a 23‑gauge needle. The cecum gently extruded a small amount of feces and was placed back in its anatomical position. The abdominal wall was sutured in layers with a 3‑0 silk braid. Following the procedure, 1 ml of 0.9% saline was injected subcutaneously. The mice were provided free access to only water. Sham model mice were operated in the same manner as the CLP model without CLP. 

Experimental design. Mice (n=6 for sham surgery and CLP) were randomly assigned to seven groups: Sham group, CLP group, adenovirus (Ad)‑green fluorescent protein (GFP) + CLP group, Ad‑miR‑214 + CLP group, anti‑miR‑214 + CLP group, PTEN inhibitor + CLP group and Ad‑miR‑214 + PTEN inhibitor + CLP group. The Sham group mice were exposed to the same procedure but without ligation and puncture of the cecum. Mice in the other groups received cecal ligation and perforation. All mice were quickly anesthetized by isoflurane inhalation to collect blood, urine and kidney samples 24 h after the last treatment. 

Adenovirus‑mediated Ad‑miR‑214, anti‑miR‑214, or Ad‑GFP gene transfer in vivo and PTEN inhibitor injection.  Ad‑miR‑214,anti‑miR‑214, or Ad‑GFP (Shanghai GenePharma Co., Ltd.) was delivered into the abdominal cavity of mice 4 days prior to CLP. Briefly, mice were anesthetized by isoflurane inhalation. A catheter containing 200 µl of adenovirus (2x1011 pfu, expressing miR‑214, anti‑miR‑214, or Ad‑GFP) was administered to normal mice via intraperitoneal injection. The PTEN inhibitor (VO‑OHpic, intraperitoneal, Sigma‑Aldrich; Merck KGaA) was administered to CLP mice that had received anti‑miR‑214 via intraperitoneal injection at a single dosage of 10 µg/kg 30 min prior to the administration of adenovirus.

Assessment of kidney function.  Blood samples were harvested from mice heart, followed by centrifugation (at room temperature for 15 min at 3,000 x g) for collecting serum. The serum levels of blood urea nitrogen (BUN) and serum creatinine (Cr) were determined using a Hitachi 7600 automatic analyzer (Hitachi, Ltd.). ELISA was used to analyze levels of kidney injury molecule‑1 (KIM‑1; cat. no. RKM100; R&D Systems,Inc.) and neutrophil gelatinase‑associated lipocalin (NGAL; cat. no. DY3508; R&D Systems, Inc.) in urine samples.

Assay for serum inflammation cytokine.  Serum TNF‑α (cat. no. H052) and IL‑6 (cat. no. H007) were examined using commercial ELISA kits (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions. Measurement of oxidative stress markers. The corresponding assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) was used to measure the levels of malondialdehyde (MDA) and test the activity of superoxide dismutase (SOD) in accordance with the manufacturer's instructions.

Histology and tubular injury score. All mice were subjected to kidney perfusion under anesthesia 24 h after CLP. The kidney specimens were fixed in 4% paraformaldehyde for 72 h at 4˚C. The tissue samples were then dehydrated in a graded series of ethanol solutions, embedded in paraffin and cutinto 4‑µm sections. Sections (4 µm) were cut using a microtome and the tissue sections were stained with hematoxylin (5 min) and eosin (1 min) at room temperature for histological examination. The slides were evaluated and graded using a microscope (BX51, Olympus Corporation). Renal tissues with the following histopathological changes were judged injured: Loss of brush border, vacuolization, cast formation, tubular dilation and disruption, cell lysis and cellular necrosis. Tissue damage was checked in a blinded manner and scored by the percentage of damaged tubules: 0, no damage; 1, 0‑25; 2, 25‑50; 3, 50‑75; 4, >75% (13).

Transmission electron microscopy (TEM). Fresh kidneys were washed in phosphate buffered saline, and cut into 1 mm cubes and sequentially fixed in 2.5% glutaraldehyde for 24 h at 4˚C. The sections were immersed in 1% osmium tetroxide for 2 h at 4˚C, dehydrated in graded ethanol and embedded in epoxyresin. Finally, the ultrathin sections (60 nm) were doubled stained with uranyl acetate and lead citrate at 20˚C for 60 min. The observation was performed on a transmission electron microscope (Tecnai; Hitachi, Ltd.) at 80 kV using Electron Microscopy Film 4489 (ESTAR thick base; Kodak).

Immunohistochemistry (IHC). Fresh kidney tissues were fifixed in 4% paraformaldehyde (for 72 h at 4˚C) and embedded in paraffin. Specimens were cut into 4 µm‑thick sections and deparaffinized in xylene. After tissue sections were washed with PBS, they were boiled in 10 mM citrate buffer (pH 6.0) for 4 min for antigen retrieval and then blocked with 10% goat serum in PBS at room temperature for 1 h. The primary antibody (anti‑LC3B; 1:400; cat. no. 4412; Cell Signaling Technology, Inc.) was added in accordance with the instructions and incubated at 4˚C for 12 h. The secondary antibody (goat antirabbit HRP; 1:2,000; cat. no. BS13278; Bioworld Technology, Inc.) was added and incubated at room temperature for 10 min. DAB (100 µl) was added and counterstained for 5 min with the staining observed under a light microscope (Model CX31‑P; Olympus Corporation). The intensity of positive staining, which appeared brown, was determined using Image‑Pro Plus 6.0 image analysis software (Media Cybernetics, Inc.). The integral optical density (IOD) was calculated to represent the intensity. IOD values increased as protein expression increased.

Reverse transcription‑quantitative (RT‑q) PCR. Total RNA was extracted from kidney tissue following the induction of the model using TRIzol reagent (Thermo Fisher Scientific, Inc.). According to the instructions of the TaqMan reverse transcription kit (cat. no. N8080234; Invitrogen; Thermo Fisher Scientific, Inc.), RNA was reverse transcribed into cDNA. The following thermocycling conditions were used (miR‑214): Initial denaturation at 95˚C for 5 min; followed by 40 cycles of denaturation at 95˚C for 30 sec, annealing at 60˚C for 30 sec and elongation at 72˚C for 30 sec. RT‑qPCR was performed using an ABI Prism 7500 Sequence Detection System (PerkinElmer, Inc.) and a standard SYBR Green PCR kit (Toyobo Life Science). U6 was used as the internal control for miR‑214. Primer sequences were as follows: miR‑214, forward, 5'‑AGCATAATACAGCAGGCACAGAC‑3' and reverse, 5'‑AAAGGTTGTTCTCCACTCTCTCAC‑3'; U6, forward, 5'‑ATTGGAACGATACAGAGAAGATT‑3' and reverse, 5'‑GGAACGCTTCACGAATTTG‑3'. These experi‑ ments were replicated six times. Results were analyzed using the 2‑ΔΔCq method (14). The mRNA expression levels of LC3, p62, PTEN, AKT and mTOR were evaluated via RT‑qPCR. With β‑actin as an internal reference of these genes, the 2‑ΔΔCq was used to measure the relative expression of target genes. The primer sequences shown in Table I were synthesized by Sangon Biotech Co., Ltd.

image

Western blotting. Kidney tissue was mixed with RIPA lysate (Beyotime Institute of Biotechnology) to make the homogenate and lysis was stopped when no visible tissue was observed. The samples were centrifuged at 13,000 x g for 10 min at ‑4˚C and the supernatant was recovered for the western blot analysis. In brief, protein concentrations were determined using the micro BCA protein assay kit (Thermo Fisher Scientific, Inc.). Protein samples (80 µg per sample) were subjected to separate by reducing 12% sodium dodecyl sulfate‑polyacrylamidegel electrophoresis and then transferred onto polyvinylidene difluoride membranes at 4˚C overnight. Separated proteins were transferred to PVDF membranes. Following blocking in 5% skimmed milk at room temperature for 2 h, membranes were incubated overnight (at 4˚C) with primary antibodies. The following primary antibodies (all Cell Signaling Technology, Inc.) were used: Light chain 3B (1:1,000; cat. no. 4412), p62 (1:1,000; cat. no. 4412), Anti‑PTEN (1:1,000; cat. no. 9188), anti‑phosphorylated (p)‑AKT (Ser473) (1:1,000; cat. no. 4060), anti‑AKT (1:1,000; cat. no. 9272), anti‑p‑mTOR (Ser 2448) (1:1,000; cat. no. 5536), anti‑mTOR (1:1,000; cat. no. 2972) and β‑actin (1:2,000; cat. no. 4970). After washing, the membranes were incubated (at room temperature for 2 h) with the HRP‑conjugated anti‑rabbit secondary antibodies (1:3,000; cat. no. A0208; Beyotime Institute of Biotechnology). Protein bands were detected with Immobilon Western (MilliporeSigma) and analyzed using Total‑Lab TL120 soft‑ ware (Nonlinear Dynamics, 2.01). The expression of protein was normalized to β‑actin.

Statistical analysis. Statistical analysis was performed using the GraphPad Prism 9.0 (GraphPad Software, Inc.). All data were presented as means ± standard deviation or medians (interquartile ranges) for continuous variables, depending on their distributions. Baseline characteristics and outcomes were compared using one‑way ANOVA followed by Tukey's posthoc test, or Kruskal‑Wallis test followed by Dunn's test as appropriate. P<0.05 was considered to indicate a statistically significant difference.

Results

Time point 24 h after CLP. Previous studies have reported (6,15,16) that biochemical (i.e., LC3 and p62) analysis reveals that autophagy flux is suppressed with progression of sepsis following 6‑8 h of CLP. In the present study, the number of autolysosomes in the kidney of CLP‑treated mice increased within 24 h following surgery. In addition, the analysis of markers of kidney injury showed that renal function was most seriously damaged 24 h after CLP. Therefore, the time point 24 h after CLP was choose for the following experiments.

Regulatory effect on miR‑214 in kidney tissues. RT‑qPCR analysis was used to detect miR‑214 expression in CLP‑treated mice. It was found that miR‑214 expression was slightly upregulated in the kidney tissues following CLP surgery 24 h, as compared with the sham group (1.47‑fold, P<0.01, Fig. 1A). The present study examined the reactive increase in miR‑214 expression during sepsis as a compensatory protective mechanism. Therefore, it evaluated the role of miR‑214 in AKI during sepsis by regulating its expression. As shown in Fig. 1B, Ad‑miR‑214 increased miR‑214 expression by 4.13‑fold 4 days after intraperitoneally injecting 2x1011 pfu/mice adenovirus, whereas anti‑miR‑214 decreased miR‑214 expression by 81.16% in the kidney tissue, as compared with the sham group (both P<0.01). By contrast, Ad‑GFP as a control group did not affect miR‑214‑3p expression, compared with the sham group (both P>0.05).

cistanche-kidney failure-6(48)

CISTANCHE WILL IMPROVE KIDNEY/RENAL FAILURE

Effect of miR‑214 on renal dysfunction in septic mice. All mice were sacrificed to collect blood, urine and kidney samples 24 h after the CLP surgery. BUN and Cr are important indicators of the severity of renal impairment (17). Furthermore, NGAL and KIM‑1 have been identified as specific biomarkers of kidney injury and their increased expression is associated with early renal tubular injury in AKI (17). As shown in Fig. 2A‑D, the levels of BUN, Cr, KIM‑1 and NGAL were significantly increased following CLP surgery compared with the sham group. However, Ad‑miR‑214 significantly decreased BUN, Cr, KIM‑1 and NGAL levels in comparison with the CLP group (all P<0.01), whereas anti‑miR‑214 exhibited opposite effects in these kidney function parameters. However, following pretreatment with PTEN inhibitor, the protection effects of Ad‑miR‑214 were enhanced. The results show that miR‑214 attenuates kidney dysfunction in septic mice.

Effect of miR‑214 on renal inflammation and oxidative stress.  As shown in Fig. 3A and B, CLP significantly elevated the levels of TNF‑α and IL‑6, whereas Ad‑miR‑214 significantly decreased the levels of these markers. Compared with the 

Effect of miR‑214 on renal autophagy in septic mice. The present study examined the changes in LC3 in kidney tissues via IHC staining. As shown in Fig. 6, the LC3 intensity of positive staining increased significantly in the CLP group compared with the sham group (P<0.01) due to the activated autophagy. The expression level of LC3 was lower in the Ad‑miR‑214 group and higher in the anti‑miR‑214 group in comparison with the CLP group (P<0.01). However, the administration of PTEN inhibitor enhanced the inhibition of autophagy effect of Ad‑miR‑214.

miR‑214 activates the AKT/mTOR pathway to inhibit autophagy by silencing PTEN in kidney tissues. The effect of CLP on autophagy in kidney tissues was investigated by assessing the levels of LC3‑II/I and p62. The PTEN/AKT/mTOR signaling pathway serves an important role in autophagy (18). To investigate the effect of miR‑214 on the PTEN‑AKT/mTOR pathway, the protein levels of LC3‑II/I, p62, AKT, p‑AKT, mTOR, p‑mTOR and PTEN were analyzed through western blotting and RT‑qPCR anal‑ ysis. As shown in Fig. 7A‑C, modification in these proteins rapidly occurs, with an increase in the rate of LC3‑II/LC3‑I, and reduction in the levels of p62 (both P<0.01) in the CLP‑induced sepsis group. Compared with the CLP group, the rate of LC3‑II/LC3‑I was significantly decreased, while the level of p62 (both P<0.01) was significantly increased in the Ad‑miR‑214 group. However, the inhibition of miR‑214 displayed an opposite tendency to the above indicators (both P<0.01). By contrast, the negative control had no effect on the changes in the rate of LC3‑II/LC3‑I and the levels of p62 in kidney tissues (both P>0.05). The two indicators of LC3‑II/LC3‑I and p62 had no significant difference among the Ad‑miR‑214 group, the PTEN inhibitor group and the Ad‑miR‑214 + PTEN inhibitor group (all P>0.05). These results showed that autophagy was induced by CLP, and the overexpression of miR‑214 could partially inhibit it. 

As shown in Fig. 7A and D‑F, the expression level of PTEN (P<0.01) was increased, and the expression levels of p‑AKT (Ser473) and p‑mTOR (Ser2448) (P<0.01) were decreased by CLP. Compared with the CLP group, the expression level of PTEN was reduced, while those of p‑AKT and p‑mTOR (all P<0.01) were subsequently increased in the Ad‑miR‑214 group. By contrast, the negative control had no effect on the changes in the expression levels of PTEN, p‑AKT and p‑mTOR in kidney tissues (all P>0.05). There was no signifi‑ cant difference in the above indicators among the Ad‑miR‑214 group, the PTEN inhibitor group and the Ad‑miR‑214 + PTEN inhibitor group (all P>0.05). These findings suggests that CLP induces kidney tissue autophagy by inhibiting the AKT/mTOR pathway. Ad‑miR‑214 activated the AKT/mTOR pathway by silencing PTEN in kidney tissues. However, compared with the CLP group, anti‑miR‑214 did not significantly inhibited the expression of mTOR. Therefore, RT‑qPCR was further used to determine the expression of mRNA of genes related to the PTEN/AKT/mTOR signaling pathway. According to the results of RT‑qPCR (Fig. 8), in comparison with the Sham group, the mRNA expression levels of p62, LC3 and PTEN were markedly increased, while the mRNA expression of AKT and mTOR were decreased in the CLP group. Compared with the CLP group, the Ad‑miR‑214, PTEN

image

image

image

image

inhibitor and Ad‑miR‑214 + PTEN inhibitor groups displayed decreased mRNA expression of LC3 and PTEN, but increased mRNA expression of p62, AKT and mTOR (all P<0.05); in the anti‑miR‑214 group, an opposite changing tendency was observed (all P<0.05). There was no significant difference in the above indicators among the Ad‑miR‑214 group, the PTEN inhibitor group and the Ad‑miR‑214 + PTEN inhibitor group (all P>0.05). Thus, the effect of p62 on autophagy may occur at the transcriptional level rather than at the post‑transcriptional level. The current results demonstrated that miR‑214 downreg‑ ulated the expression of PTEN and activated the AKT/mTOR signaling pathway.

Discussion

The present study found that excessive autophagy was detrimental to renal function in septic mice. Previous studies have shown that miR‑214 is associated with increased proliferation, metastasis, invasion and functions as an oncogene for cells and tissues (19‑22). Studies report that miR‑214 serves a protectiverole against AKI via attenuating apoptosis, oxidative stress and downregulating inflammatory factors (21,23). The present study further examined the mechanisms underlying the protective effect of miR‑214 on sepsis‑induced AKI by focusing on the potential involvement of miR‑214 in the modulation of autophagy. The results showed that oxidative stress occurred in the kidney following the administration of CLP surgery. Meanwhile, the activation of autophagy occurs in the kidney. Elevated LC3 II/I and the reduction of p62 in the kidney was observed following treatment with CLP surgery. As expected, the overexpression of miR‑214 significantly attenuated kidney pathological injuries and kidney dysfunction caused by sepsis. However, the inhibition of miR‑214 displayed an opposite tendency to renoprotection. In addition, the protection effect of Ad‑miR‑214 was enhanced by PTEN inhibitor.

In a septic kidney, excessive inflflammation is accompanied by massive increases in the production of ROS and a large number of ROS triggers changes in mitochondrial structure and impairs mitochondrial function, which causes the body to enter a vicious cycle which aggravates kidney damage (24,25). Therefore, oxidative stress may be one of the main pathological mechanisms of sepsis‑induced AKI. The present study provided further evidence demonstrating excessive oxidative stress, which was indicated by increased MDA production and reduced SOD activity in the kidney tissues following CLP surgery. Moreover, it was found that the overexpression of miR‑214 could protect the kidney against CLP‑induced oxidative injury, which is involved in autophagic inhibition. This is consistent with the previous studies that miR‑214 protects various cells and tissues against oxidative stress (26,27).

Autophagy serves as a 'double‑edged sword' in the development of sepsis: Basal autophagy can exert protective effects by removing toxic oxidative proteins, but excessive autophagy may lead to autophagic cellular death under severe stress, such as ROS eruption (28,29). It has been shown that autophagy is activated initially in sepsis, followed by a subsequent phase of dysfunction due to autophagic cell death (30), which aggravates sepsis‑induced oxidative injury. In the present study, PTEN inhibitor or overexpression of miR‑214 displayed antioxidative renoprotection in CLP‑treated mice. However, the inhibition of miR‑214 displayed an opposite tendency to antioxidative renoprotection. So excessive or inadequate autophagy can cause kidney damage; both are maladaptive and eventually provoke cell death. Hence, keeping moderate levels of autophagy is the key to attenuate oxidative injury in septic condition.

kidney pain-1(25)

CISTANCHE WILL IMPROVE KIDNEY/RENAL PAIN

Accumulating evidence has indicated that miR‑214 inhibits autophagy in various cells and tissues (31‑33). In the present study, the overexpression of miR‑214 was found to inhibit CLP‑induced autophagy in kidney tissues, as indicated by the changes in protein markers, such as LC3‑II/I and p62. Furthermore, the results demonstrated that overexpression of miR‑214 attenuated CLP‑induced oxidative injury by inhibiting excessive autophagy. The present study also investigated the molecular mechanisms by which miR‑214 modulates kidney autophagy in sepsis‑induced AKI. PTEN/AKT/mTOR is an important signaling pathway that regulates kidney autophagy (34,35) and which serves a keyrole in sepsis‑induced AKI, and PTEN is a negative inhibitor of the PI3K/AKT/mTOR signaling pathway. Previous studies reported that miR‑214 can regulate autophagy through the PI3K/AKT/mTOR signaling pathway in various models (36‑38). Ma et al (39) found that miR‑214 can down‑ regulate autophagy in diabetic kidneys. Therefore, it was hypothesized that the effects of miR‑214 on CLP‑induced AKI might be involved in the regulation of the PTEN/AKT/mTOR pathway. Notably, the results of the present study showed that CLP surgery significantly elevated the levels of PTEN but decreased the levels of p‑AKT and p‑mTOR, indicating that CLP surgery inactivated the AKT/mTOR pathway. In addition, the overexpression of miR‑214 activated the AKT/mTOR pathway by the silencing of PTEN in CLP‑induced autophagy in kidney tissues. However, anti‑miR‑214 did not significantly inhibited the expression of mTOR in western blot analyses. Thus, RT‑qPCR was further used to determine the expression of mRNA of genes related to the PTEN/AKT/mTOR signaling pathway. The present study identified that miR‑214 downregulated the expression of PTEN and activated the AKT/mTOR signaling pathway to inhibit autophagy. However, further exhaustive studies should be carried out to obtain additional details related to the mechanism of kidney autophagy in septic condition.

To conclude, the results of the present study suggested that miR‑214 served a protective role against sepsis‑induced kidney injury by reducing oxidative stress and inhibiting autophagy through regulation of the PTEN/AKT/mTOR pathway. The present fifindings suggested that miR‑214 may be a potential therapeutic target for sepsis‑induced AKI. However, the present study used mice 6‑8 week old, so further research on the mechanism of miR‑214 is needed in adult mice.

You Might Also Like