A Diet Containing Rutin Ameliorates Brain Intracellular Redox Homeostasis in A Mouse Model Of Alzheimer’s Disease Part 2

Jun 14, 2023

2.6. Expression of Caspase-3 and Caspase-6

Glycoside of cistanche can also increase the activity of SOD in heart and liver tissues, and significantly reduce the content of lipofuscin and MDA in each tissue, effectively scavenging various reactive oxygen radicals (OH-, H₂O₂, etc.) and protecting against DNA damage caused by OH-radicals. Cistanche phenylethanoid glycosides have a strong scavenging ability of free radicals, a higher reducing ability than vitamin C, improve the activity of SOD in sperm suspension, reduce the content of MDA, and have a certain protective effect on sperm membrane function. Cistanche polysaccharides can enhance the activity of SOD and GSH-Px in erythrocytes and lung tissues of experimentally senescent mice caused by D-galactose, as well as reduce the content of MDA and collagen in lung and plasma, and increase the content of elastin, have a good scavenging effect on DPPH, prolong the time of hypoxia in senescent mice, improve the activity of SOD in serum, and delay the physiological degeneration of lung in experimentally senescent mice With cellular morphological degeneration, experiments have shown that Cistanche has the good antioxidant ability and has the potential to be a drug to prevent and treat skin aging diseases. At the same time, echinacoside in Cistanche has a significant ability to scavenge DPPH free radicals and has the ability to scavenge reactive oxygen species and prevent free radical-induced collagen degradation, and also has a good repair effect on thymine free radical anion damage.

cistanche tubulosa

Click Here To Know Cistanche Tubulosa For Antioxidant

【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】

TgAPP mice showed an increase in caspase-3 gene expression (Figure 8C1, H1), which was significant and greater than 30% compared to the hippocampi of WT mice (Figure 8H1; p < 0.05). As for caspase-6 expression, no differences were observed between transgenic and non-transgenic mice (Figure 8C2, H2).

cistanche tubulosa

Quercetin and rutin treatments were able to lower caspase-3 mRNA levels in the hippocampus in a statistically significant manner (Figure 8H1; p < 0.05), with inhibition percentages of around 17% and 27% for female and male mice, respectively. In the cerebral cortex, significant differences were only observed in the treatment with rutin in males (Figure 8C1; p < 0.05). 

About caspase-6, quercetin and rutin treatments did not exert any statistically significant effect in the cortex or the hippocampus (Figure 8C2, H2), though in the latter the Caspase-6 in TgAPP males showed a tendency to decrease (Figure 8H2).

2.7. Inflammation Markers

The results obtained for gene expression of the inflammatory mediators IL-1β, TNF-α,  and IFN-γ are shown in Figure 9. 

In the TgAPP, there was a significant increase in IL-1β gene expression of around 20% in the cortex and hippocampus in both sexes compared to WT mice (Figure 9C1, H1;  p < 0.05). As regards TNF-α, although higher mRNA levels are shown in TgAPP, they are not statistically significant in WT mice (Figure 9C2, H2). Regarding IFN-γ,  there was an increase of around 30% in its expression in males, which was only statistically significant in the cortex (Figure 9C3; p < 0.05).

cistanche reddit

Treatments with quercetin and rutin, both in females and males, were able to diminish IL-1β expression in the cerebral cortex and hippocampus in comparison to control TgAPP mice (Figure 9C1, H1; p < 0.05), obtaining similar values to those of WT mice, and particularly lower in the hippocampi of male mice (Figure 9H1; p < 0.05).

The overall effect of both flavonoid treatments on IL-1β expression was not observed with TNF-α nor with INF-γ. Thus, TgAPP males, upon quercetin treatment, underwent a significant decrease in hippocampal TNF-α (Figure 9H2; p < 0.05) and in cortical IFN-γ expression (Figure 9C3; p < 0.05).

2.8. Assessment of Degenerating Neurons and Their Projections

No characteristic signs of neurodegeneration were observed at the age at which the transgenic TgAPP mice were tested, compared to WT mice, nor did treatments with quercetin and rutin show any change for 4 weeks in comparison to TgAPP (Figure S1, Supplementary data).

2.9. Expression of Ionotropic Glutamate Receptors

No significant differences were found in receptor expression, comparing the values obtained for the control TgAPP mice with those obtained for the WT mice. There were also no notable effects on the expression of these ionotropic receptors in the presence of quercetin or rutin treatment (Table S5, Supplementary data).

cistanche and tongkat ali reddit

3. Discussion

The purpose of our present study was to assess the impact of two flavonoids, quercetin, and rutin, at the first stages of AD pathogenesis, regardless of their effect on neurodegeneration and/or cognitive function. The cortex and hippocampus were the areas of the brain under analysis, as they are the most affected brain structures in AD. It should be taken into account that quercetin and rutin were administered through a formulated diet containing either one of the two flavonoids, to mimic, in an AD animal model, the intake of a healthy human diet, containing an active ingredient.

In particular, the transgene APPswe in the C57B6 mouse exerted a significant impact on GSH/GSSG ratio, MDA levels, antioxidant enzyme capacity, APP expression, BACE1  activity, and caspase-3 and IL-1β expression. Whilst APP mutations in humans generally result in typical AD, they are predominantly linked to solely amyloid pathology in APP  transgenic mice and there is no noticeable neurodegeneration [14,15], as there were no characteristic signs observed in our transgenic mice TgAPP, contrary to the WT mice (Supplementary data, Figure S1). Counterstaining with 40 -6-diamidino-2-phenylindole (DAPI) of hippocampal neurons allowed us to observe the nuclear morphology, as this compound is a fluorescent dye for nucleic acids. We did not observe fragmented or lobular nuclei, typically apoptotic; nor did we observe any remarkable differences comparing the hippocampal histological sections of the control transgenic line TgAPP concerning the WT sections; nor did we observe any differences between the quercetin and rutin treatments concerning the control TgAPP mice.

In the panel of AD biochemical features to be analyzed, we focused primarily on determining the GSH/GSSG ratio upon either one of the two flavonoid diets, since depletion of GSH levels represents one of the most important early biochemical markers in AD [16,17]  and has been observed during its pathogenesis and disease progression. Measurement of brain GSH levels [18] and, more recently, blood GSH levels [19] have been promising as diagnostic markers for the early stages of AD. Moreover, efforts have also been made to supplement endogenous GSH stores by themselves or their precursors [20–22]. In our study,  a decline in the cellular reducing power (GSH/GSSG) was observed in the TgAPP mice concerning WT animals, in both males and females, and in both areas of the brain. In the cortex and hippocampus of both WT and TgAPP mice, the GSH/GSSG ratio was lower in males than in females. Quercetin and rutin diets significantly increased the GSH/GSSG ratio in comparison to untreated TgAPP mice, and this increase was more pronounced in the hippocampus. The changes in GSH and GSSG levels and GSH/GSSG ratio upon quercetin or rutin treatment of males, regarding increasing redox power, were more prominent than in females. The results from our determinations may reveal an important basis underlying sex-associated differences in Tg2576 mice in the susceptibility to the oxidative damage of macromolecules on one hand, since the glutathione system is a versatile reductant in multiple biological functions, and in the impact of preventive flavonoid diets in restoring its physiological status on the other hand. As we will see throughout this discussion, we have set the increase in the GSH/GSSG ratio as the main axis that might explain the set of effects observed in the TgAPP mice.

It has recently been proposed that the GSH/GSSG ratio, rather than simply functioning as a redox buffer, would instead operate as a main regulatory mechanism, allowing proteins to attain their native conformation and functionality by tightly controlling the thiol-disulfide balance of the cellular proteome. In short, the glutathione system arises as essential to preserve a healthy proteome, showing that disruption of glutathione redox homeostasis (i.e., genetically or pharmacologically) increases protein aggregation due to disturbances in the efficacy of autophagy [23]. Therefore, strategies aimed at maintaining glutathione redox homeostasis may have therapeutic potential in diseases associated with protein aggregation, such as AD. Closely related to the preservation of the proteome is the ubiquitin–proteasome degradation machinery, which is involved in the pathogenesis of AD. The proteasome selectively degrades multiple substrates that are crucial in maintaining neuronal homeostasis, including the catabolism of oxidized and aggregated proteins. BACE1 undergoes ubiquitination, and it has been demonstrated that blocking the ubiquitin–proteasome pathway will inhibit BACE1 degradation and consequently lead to increased production of BACE1 enzymatic activity, more β-cleavage product C99, and increases in both Aβ1-40 and Aβ1-42 in neuronal and non-neuronal cells [10]. Our previous studies have found that both flavonoids, quercetin, and rutin, affect various signaling pathways and molecular networks associated with the modulation of proteasome function in neuroblastoma cells [9]. In addition, it has been demonstrated that neurons supplemented with reduced glutathione (GSH) recovered the proteasome activity and reduced aggregate formation [11] since the proteasome function is redox status-regulated [24]. Therefore, the increase in the GSH/GSSG ratio experienced by the animals upon having a quercetin or rutin diet is consistent with the modulation of the proteasome by quercetin and rutin, demonstrated ex vivo previously.

As previously mentioned, redox imbalance leads to highly oxidatively-modified proteins that tend to accumulate and create aggregates resulting in proteasome impairment [25]. Thus, given the crucial role of oxidative stress in the pathogenesis of AD, biomarkers of oxidative stress, including lipid peroxidation (MDA levels) and antioxidant enzymes, were assessed in the cortex and hippocampus in the TgAPP and WT mice. SOD, CAT, GR, and GPx are the most important antioxidant enzymes that act against oxygen free radicals and regulate the metabolism of free radicals in the body and play a role in the free radical scavenging system, protecting the cells in the body from lipid peroxidation. In our study,  as a consequence of APP overexpression, a generalized decrease in antioxidant enzyme activities was observed in TgAPP mice compared to WT mice, being statistically significant for CAT. Consistent with reduced GSH levels, lipid peroxidation was significantly increased in the TgAPP mice. While the source of oxidative stress in human AD is highly complex and multifactorial, the amyloid pathology developed in mice seems to be sufficient to initiate the pathological process leading to increased oxidative stress in the brain [26]. Animals treated with rutin experienced an increase in CAT activity in the cortex and GR  activity in the hippocampus, in both males and females. Only animals treated with rutin experienced changes in gene expression of CAT and GR in the cortex and the hippocampus in both males and females and GPx in the hippocampi of female mice. In this context,  several natural compounds have been shown to affect the crosstalk between the proteasome and redox regulation. More precisely, quercetin is a known Nrf2 activator [27] that exhibits antioxidant properties through the stimulation of proteasome function, promoting increased oxidative stress resistance and conferring enhanced cell longevity [28].

cistanche nedir

Tissue-specific expression of BACE1 is critical for normal APP processing, and its dysregulation expression may play a role in AD pathogenesis. BACE1 is predominantly expressed in hippocampal neurons, the cortex, and the cerebellar granular layer [10]. It should be noted that earlier studies have shown that Swedish mutant APP transgenic mice had significantly increased brain levels of Aβ at a steady state [29], suggesting that BACE1  plays an essential role in the amyloidogenic pathway in AD pathogenesis and is a good therapeutic target for AD treatment. In our study, we observed a significant reduction of BACE1 activity upon quercetin and rutin treatments, which might contribute to the decrease of Aβ deposition in mice. We argue that more than solely operating as BACE1  inhibitors of the enzyme, quercetin, and rutin might exert a reduction in BACE1 activity related to an increase in the ratio GSH/GSSG, based on the hypothesis of enhancing recovery of proteasome activity. In this sense, it is known that targeting of BACE1 inhibitors to the β-cleavage site of APPswe (Swedish mutation) occurs before it reaches the plasma membrane, whereas APPwt (Wild-type) is processed in an early endosome originating at the cell surface. Therefore, BACE1 that cleaves APPwt is sometimes bound to the BACE1  inhibitor on the cell surface before APP processing, however, the enzyme that processes APPswe is not [30]. It is for this reason that the aberrant localization of APPswe processing might significantly lower the potency of quercetin and rutin as BACE1 inhibitors. Thus,  we are more inclined to support that the BACE activity’s decrease in this in vivo model is not so much due to the inhibition of the enzyme but to the increase in the GSH/GSSG  ratio. In any case, reduced BACE1 activity could be interpreted as a putative attempt to reduce β-amyloid production in the TgAPP mice. As for the most remarkable effect of quercetin and rutin in the hippocampus on BACE1 activity attenuation, it is worth noting that the cortex has a significantly higher neuron density than the hippocampus [31], and selective impairment of the proteasome in AD pathological phenotype makes the cortex more vulnerable and affected than the hippocampus [32].

After determining the effect of the treatments on BACE1 enzyme activity, we were interested in evaluating its expression. Curiously, no significant differences in BACE1  expression were found between TgAPP mice compared to WT mice, and no noticeable changes were observed with quercetin or rutin treatment. Therefore, it seems that the increase in BACE1 enzyme activity is not associated with an increase in expression. In this context, it is remarkable that Apelt et al. [14] found an increase in cortical BACE1 activity in Tg2576 mice between the ages of 9 and 13 months while the expression level of BACE1 protein and mRNA did not change with age. Furthermore, evidence has been found supporting that fibrillar amyloid Aβ1–42., rather than soluble amyloid Aβ1–42, can upregulate BACE1 protein expression, and thus small modifications in the ratio of amyloid isoforms may modulate amyloid aggregate conformations and cell damage [33]. Thus, the absence of change in BACE1 expression upon an increase of its activity that we found may account for the prevalence of soluble amyloid Aβ1–42 over the fibrillar amyloid Aβ1–42 isoform in our mouse model TgAPP.

Following the determination of gene expression of the enzymes involved in APP processing, we evaluated the effect of quercetin and rutin on the enzyme α-secretase involved in the non-amyloidogenic processing of APP. We focused on ADAM10 because it is the physiologically most important constitutive isoform of α-secretase. ADAM10 counteracts the generation of neurotoxic oligomeric Aβ plaques via cleaving APP within the Aβ domain to produce sAPPα and C-terminal fragments (α-CTF) [34,35]. Although the changes in ADAM10 expression found in our study were not statistically significant, a slight decrease in ADAM10 expression was observed in TgAPP mice relative to WT mice. Predominantly,  rutin treatment showed a tendency to increase ADAM10 gene expression in both brain areas under study. Postina et al. [36] showed that the up-regulation of wild-type ADAM10  in the hippocampus of an AD mouse model mediated sAPPα secretion, leading to the inhibition of Aβ plaques generation. The effect of quercetin has been studied in an aluminum chloride-induced AD rat model showing a significant enhancement of the α-secretase (ADAM10 and ADAM17) in the hippocampus compared to untreated ones. This indicates that quercetin possesses the potential to increase the non-amyloidogenic pathway through the activation of α-secretase genes [37]. Preclinical data reinforce the hypothesis that enhancing brain sAPPα levels is a potential strategy to improve AD-related symptoms and attenuate synaptic deficits. ADAM10 and BACE1 compete for the APPβ cleavage, therefore potentiating ADAM10 activity might inhibit the neurotoxic amyloid generation. Moreover,  sAPPα can prevent the activation of the stress JNK-signaling pathway, leading to the activation of NF-κB-induced phosphorylation activity, which leads to proteasome degradation [38]. Therefore, the formation and the accumulation of disease-related protein aggregates are significantly reduced, and the cellular proteasome activity is enhanced, thereby providing evidence for a function of sAPPα in the regulation of proteostasis [39]. Furthermore, it has been demonstrated that sAPPα specifically upregulates glutamate AMPA receptor synthesis and its trafficking [40]. In our study, we explored whether the slight increase of ADAM10 expression upon rutin treatment exerts some influence on glutamatergic synaptic transmission. As shown in the Supplementary data section, no significant effects on the expression of this ionotropic receptor were observed upon quercetin and rutin diets,  perhaps due to a weak increase in ADAM10 expression, which is not sufficient for the upregulation of the AMPA receptor (Supplementary data, Figure S2 and Table S5).

It should be taken into consideration that in vitro studies have shown a wide variety of ADAM10 substrates [41], and therefore, undesirable effects obtained by non-specific ADAM10-targeting might be found in cancer proliferation, cell adhesion, promotion of T  cell/NK-cell precursor and inflammation, etc. [42]. To circumvent this constraint, our study suggests a strategy aimed at promoting the release of sAPPα more physiologically. This approach might be based on a long-term intake of an active ingredient (quercetin or rutin), which is consumed through a healthy human diet. However, further studies are needed to find out whether the increase in ADAM10 is flavonoid dose-dependent and whether the potential beneficial effects outweigh the putative side effects.

As for the expression of APPswe, although the insertion of the human APP transgene in the mouse genome guarantees that APPswe is overexpressed from birth, it has been reported that APP mRNA and protein hippocampal levels show significant fluctuations during animal development, being maximal when mice are asymptomatic (1-month-old) and decreasing when full symptomatology occurs [43]. Notwithstanding this issue, APP expression both in the cortex and the hippocampus was significantly higher compared to that of WT mice in our study. Further treatment with quercetin or rutin was able to significantly reduce such expression for both male and female mice, in both areas of the brain. These findings are in line with those reported by Augustin et al. [44] who studied a standardized extract of Ginkgo biloba (Egb761), rich in flavonols such as quercetin,  in 4-month-old female TgAPP mice, finding decreased APP mRNA and protein levels. Taking into consideration that upregulation of APP translational in Tg2576 mice occurs in the prodromal and early symptomatic stages [45], it is likely that restoration of APP  translation by quercetin or rutin might have taken place in our TgAPP mice and, likely, in an early symptomatic stage, resulting in a reduction of cortical and hippocampal levels of APP, BACE1 activity, and caspase-3 activation.

Furthermore, it has been reported elsewhere that in Tg2576 mice (in the absence of neuronal loss) there is an increase in caspase-3 activation in the hippocampus [46], as found in our study, at the onset of memory impairment, together with a reduction in dendritic spines before the deposition of extracellular amyloid [46]. There is evidence in support of non-apoptotic roles for caspases in the nervous system without neuronal death [47], and  caspase-3 activity has been localized to dendritic spines where it may elevate calcineurin levels. In turn, the dephosphorylation of the GluR1 subunit of AMPA-like receptors, triggered by calcineurin is thought to result in postsynaptic dysfunction. Our values of caspase-3  expression, as a consequence of transgenesis, are in agreement with those obtained by other researchers who reported an increase in caspase-3 expression at the level of dendritic spines in the hippocampus of TgAPP mice [48]. Since APP contains three distinct cleavage sites for caspase-3 in its amino acid sequence, two of which are located at the level of the extracellular domain and one in the intracellular C-terminal portion of the APP tail [49],  hydrolysis of APP by caspase-3 may alter the proteolytic processing of APP in favor of the amyloidogenic pathway [50], leading to the release of a cytotoxic C-terminal-derived peptide of 31 amino acids in length (C31), for example [51]. This suggests that, since  caspase-3 can mediate the amplification of toxic fragment release from APP, lowering  caspase-3 expression by quercetin or rutin may allow for the clearance of aggregated protein. In addition, as mentioned earlier, we have explored the influence of both the increase and decrease of caspase-3 expression in glutamatergic synaptic transmission,  based on the ability of calcineurin-activated caspase-3 to dephosphorylate the GluR1  subunit of AMPA receptors at the postsynaptic level. These molecular modifications alter glutamatergic synaptic transmission and neuronal plasticity at the level of dendritic spines in the hippocampus [48]. Theoretically, pharmacological inhibition of caspase-3 activity in TgAPP mice might save the AD-like phenotypes from a mechanism that drives synaptic failure. However, despite the augmentation in caspase-3 expression in our TgAPP mouse,  we found no significant differences in AMPA receptor expression compared to that in WT mice, as mentioned earlier. It might be that the changes in caspase-3 expression are not prominent enough to produce significant modifications in AMPA receptor expression (Supplementary data, Figure S2 and Table S5).

As for the values of caspase-6 expression, no significant differences were found between TgAPP and WT mice. Activation of caspase-6 has been identified as an important mediator of neuronal stress that cleaves important cytoskeletal proteins (Tau and α-tubulin),  thus disrupting the ubiquitin–proteasome degradation of misfolded proteins, and several actin-regulating post-synaptic density proteins [52]. The unchanged expression of  caspase-6 in our study agrees with the absence of characteristic signs of neurodegeneration at the age at which these transgenic mice were evaluated, compared with the WT mice (Supplementary data, Figure S1).

A marked increase in neuroinflammatory mediators has been observed in AD patients,  mainly around senile plaques [53–55]. Astrocytes are the main supplier of GSH to microglia and neurons. During chronic inflammation and oxidative stress, astrocytes release toxic inflammatory mediators and free radicals, accelerating the activation of microglia and neurodegeneration [56]. It is worth noting that decreased intracellular glutathione is related to the activation of the inflammatory pathways, p38 MAP-kinase, Jun-N-terminal kinase (JNK), NF-κB, in human microglia and astrocytes [57]. In this regard, we decided to quantify the levels of IL-1β, IFN-γ, and TNF-α in our animal model and determine the effect of quercetin and rutin on them. As is known, inflammation promotes defective processing of Aβ peptide and APP, promoting Aβ peptide aggregation and in turn modifying Aβ reactivity [58]. Thus, in our study, we observed that TgAPP mice had increased mRNA levels of the pro-inflammatory mediators IL-1β, TNF-α and IFN-γ, compared to WT mice, showing that overexpression of APPswe might induce neuro-inflammatory cascades triggering a  series of molecular pathways in glia and neurons, which would activate the inflammatory response. Quercetin and rutin were able to attenuate IL-1β gene expression in both males and females and the brain areas studied. Several pieces of evidence support the antiinflammatory effect exerted by quercetin at the CNS level, as it may inhibit the activation of transcription factors such as the nuclear factor-kappa B (NF-κB) [59], involved in the induction of iNOS, and therefore, decrease the release of mediators such as IL-1β, TNF-α and IFN-γ [60]. Regarding the impact of GSH on the inflammatory response, it should be noted that GSH is involved in the maintenance of optimal cytokine levels in such a way that the expression of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) are increased due to GSH depletion, whereas the expression of anti-inflammatory cytokines (i.e., IL-10)  remained unaltered. This GSH homeostasis alteration happens due to upregulation in NF-κB and JNK signaling pathways which could be the feasible apoptotic pathway towards neuronal cell death [61]. In our study, down-regulation of NF-κB by quercetin and rutin might be a plausible mechanism to recover the GSH/GSSG homeostasis and therefore the cause of the balance between pro-inflammatory and anti-inflammatory cytokines. Lastly,  since the BACE1 promotor has an NF-κB binding site, inflammation-induced activation of NF-κB facilitates the upregulation of BACE1 expression, and subsequently increases Aβ production [62]. Thus, if down-regulation of NF-κB occurs upon quercetin and rutin diets, BACE1 activity would decrease as a result of the release regulation of pro-inflammatory and not anti-inflammatory cytokines.

4. Material and Methods

4.1. Experimental Animals 

A transgenic mouse (Tg2576, B6; SJL-Tg(APPswe)2576 Kha) that expresses the Swedish double mutation of human amyloid precursor protein (hAPP) was used as the animal model of experimental AD [14]. The mouse is a knock-in heterozygote line that expresses the human AβPP695 isoform with the double Swedish mutation (K670N/M671L; Lys670→Asn  and Met671→Leu) under the control of the hamster prion protein promoter [63]. As a result,  this mouse exhibits levels of human amyloid-β precursor protein (Aβ PP), six times greater than that of a mouse’s Aβ PP levels. In addition, this mouse shows higher levels of Aβ40  and Aβ42. Aβ deposits begin at 9 months of age [63]. Within the Tg2576 hippocampus and cortex, APPswe transgene expression is primarily neuronal [64].

cistanche side effects reddit

As a negative control, wild-type (WT) mice from the same colony [65,66] were used. The Tg2576 (B6; SJL-Tg(APPswe)2576 Kha) mouse colony was developed in our laboratory from Tg2576 heterozygous males and wild-type females. The transgenic parents were donated by Dr. Diana Frechilla from the Neuroscience Division at the Centre for Applied Medical Research at the University of Navarra (Pamplona, Spain) [67].

Animals were housed in individually ventilated cages and kept at 22–24 ◦C on a 12-h  light/dark cycle in 50–60% humidity. Animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at the Complutense University of Madrid and were in full accordance with the European Directive 2010/63/on the protection of animals used for scientific purposes and Spanish legislation on Animal Welfare (Royal Decree 53/2013, 1 February 2013).

4.2. Genotyping Analyses of Mice

Transgenicity was determined within 30 days of birth by tail biopsy. Genotyping analyses of animals were carried out by PCR. Considering that Tg2576 (TgAPP) is a  heterozygous line, the insertion gene (PrP, from prion protein) was used as a positive reaction control. Genomic DNA was extracted from mouse tails digested with proteinase K (0.1 µg/µL) in NID buffer (50 mM KCl, 50 mM Tris-HCl pH 8.3, 50 mM MgCl2, 0.05%  gelatin, 0.45% NP-40 and 0.4% Tween 20) at 56 ◦C for 3 h and shaken. DNA fragments were precipitated with isopropanol and washed with 70% ethanol. DNA precipitates were dissolved in 30 µL of TE buffer (10 mM Tris-1 mM EDTA). The purity and concentration of DNA were determined at 260 and 280 nm.

The PrP and APP genes were amplified by PCR. Sequences of primers used to screen the transgenic mice were as follows: PrP forward: CCTCTTTGTGACTATGTGGACTGATGTCGG; PrP reverse: GTGGATACCCCCTCCCCCAGCCTAGACC; APP reverse: CCAGATCTCTGAAGTGAAGATGGATG. The steps of the PCR reaction were as follows: denaturation at 94 ◦C for 90 s, 39 cycles at 60 ◦C for 60 s and 72 ◦C for 90 s, then final extension at 72 ◦C for 7 min.

In all cases, negative controls (without DNA mold) and positive controls of the APP  gene were considered. The PCR products obtained were separated by electrophoresis in 1.5% agarose gels in 0.5X TBE (Tris-Borate-EDTA, Merck KGaA, Darmstadt, Germany)  buffer at 70 V (constant voltage) and then imaged by staining with GelRed (Millipore).

4.3. Animal Treatments

TgAPP mice and wild-type littermates, both aged 6–7 weeks with an initial body weight of 16.2 ± 0.8 g, were randomized into the following four groups (n = 8/group): (a) Untreated TgAPP; (b) Quercetin-treated TgAPP; (c) Rutin-treated TgAPP; and (d) Untreated wild-type. Since both male and female mice were studied, two sets of groups were established. At the age of 45 weeks, the mice started to be treated with quercetin or rutin for 4 weeks.

Quercetin (3,30,40,5,7-pentahydroxyflavone) and rutin hydrate (quercetin-3-O-rutinoside  hydrate) were ≥95% pure and purchased from Sigma–Aldrich. Each one of the flavonoids was incorporated into a standard diet (Harlan Ibérica, Barcelona, Spain) at a concentration of 200 ppm, corresponding to an intake of 30 mg flavonoid/kg body weight/day. The untreated mice received exclusively the un-supplemented standard diet. Diets and water were provided for ad libitum intake.

4.4. Brain Tissue Preparation for Biochemical and Histological Assays

At the end of treatment, mice were fasted overnight, they were euthanized using cervical dislocation, and the entire brain was quickly removed. The brain was rinsed in saline at 4 ◦C and the arachnoid membrane was carefully removed. Then, the hippocampus and cortex were isolated. Samples were immediately stored at −80 ◦C until further use.

The entire brains of some animals were used for obtaining histological sections, for which, once euthanized using cervical dislocation, brains were frozen by immersion in isopentane at −80 ◦C. Immediately afterward, coronal sections of the brain (30 µm of thickness) were made from the olfactory bulb to the cerebellum, 120 µm apart in a  cryostat (Leica CM1850, Nussloch, Germany). The whole procedure was performed at −20 ◦C. Histological sections were collected on slides and kept at −80 ◦C until analysis (See Supplementary Methods).

4.5. Glutathione

For glutathione tests, cerebral cortex and hippocampus samples were homogenized in a redox-quenching buffer-5% Trichloride acetic acid (RQB-5% TCA) (previously bubbled with N2 for 15 min on ice) at a concentration of 25 mg/mL (w/v). Samples were resuspended by sonication for 10 s, then centrifuged at 12,000× g for 10 min at 4 ◦C, and supernatants were collected.

Then, in the supernatant obtained, spectrofluorometric methods were adopted to determine GSH and GSSG levels using the o-phthalaldehyde method, described by Senft et al. [68]. GSH and GSSG values were corrected for spontaneous reaction in the absence of a biological sample. In both cases, supernatants were incubated for 30 min at room temperature and afterward, fluorescence was measured using a FLUOSTAR microplate reader (BMG LABTECH, Ortenberg, Baden-Württemberg, Germany), with the excitation filter set at 360 nm (bandwidth 5 nm) and the emission filter set at 460 nm (bandwidth 5 nm). The concentration of GSH and GSSG in each sample was interpolated from known GSH standards. Concentrations of both GSH and GSSG were expressed as nmol GSH/mg protein, which allowed for the calculation of the glutathione redox ratio GSH/GSSG.

The remaining pellets were vortexed until completely dissolved in 240 µL of 0.1 M NaOH to measure protein concentration by the bicinchoninic acid (BCA) method, using bovine serum albumin as a standard.


【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】

You Might Also Like