A Novel Homozygous KLHL3 Mutation As A Cause Of Autosomal Recessive Pseudohypoaldosteronism Type II Diagnosed Late in Life
Nov 02, 2023
Abstract Introduction:
Pseudohypoaldosteronism type II (PHA II) is a Mendelian disorder, featuring hyperkalemic acidosis and low plasma renin levels, typically associated with hypertension. Mutations in WNK1, WNK4, CUL3, and KLHL3 cause PHA II, with dominant mutations in WNK1, WNK4, and CUL3 and either dominant or recessive mutations in KLHL3. Fourteen families with recessive KLHL3 mutations have been reported, with diagnosis at the age of 3 months to 56 years, typically in individuals with normal kidney function.
Methods: We performed clinical and genetic investigations in a patient with hyperkalemic hypertension and used molecular dynamics simulations, heterologous expression in COS7 cells, and Western blotting to investigate the effect of a KLHL3 candidate disease mutation on WNK4 protein expression.
CLICK HERE TO GET HERBAL FORMULATION OF CISTANCHE FOR KIDNEY
Results: The patient, a 58-year-old woman from a consanguineous family, showed hypertension, persistent hyperkalemic acidosis associated with severe muscle pain, nephrolithiasis, chronic kidney disease (CKD), and coronary heart disease. Therapy with hydrochlorothiazide corrected hyperkalemia, hypertension, and muscle pain. Genetic analysis revealed a homozygous p.Arg431Trp mutation at a highly conserved KLHL3 position. Simulations suggested reduced stability of the mutant protein, which was confirmed by Western blot. Compared with wild-type KLHL3, cotransfection of p.Arg- 431Trp KLHL3 led to increased WNK4 protein levels, inferred to cause increased NaCl reabsorption via the thiazide-sensitive carrier and PHA II.
Conclusions: Even in patients presenting late in life and in the presence of CKD, PHA II should be suspected if renin levels are low and hyperkalemic acidosis and hypertension are inadequate for the CKD stage, particularly in the presence of a suspicious family history.
Introduction
Systemic arterial hypertension affects over 1.1 billion adults worldwide [1] and is considered the most important modifiable risk factor for all-cause morbidity and mortality worldwide [2]. Approximately 90% of adult patients have so-called primary or essential hypertension with multifactorial gene-environment etiology [2], whereas an underlying cause of hypertension can be identified in the remainder. Common causes of secondary hypertension are primary aldosteronism, obstructive sleep apnea, parenchymal renal disease, and renal artery stenosis [3]. In rare cases, hypertension is inherited as a mono-genic trait. Affected patients typically present with low plasma renin levels, whereas aldosterone and electrolyte levels vary depending on the underlying etiology [4]. Mendelian forms of hypertension often manifest in childhood or youth. Adults are rarely investigated for mono-genic hypertension; thus, its prevalence in the general population remains unknown. In a selected cohort (inclusion criteria at least one of: age at onset ≤35 years, resistant hypertension, hypertension with electrolyte abnormalities, hormonal abnormalities, abnormal imaging results, or suggestive clinical signs), 37 candidate genes were screened, and pathogenic or likely pathogenic variants were identified in 33 of 1,179 cases (2.8%) [5].
This study focuses on pseudohypoaldosteronism type II (PHA II), a form of Mendelian hypertension that features hyperkalemic acidosis and low plasma renin levels [6]. PHA II is also known as familial hyperkalemic hypertension. It was first described in 1964 by Paver and Pauline in a young male with severe hypertension and hyperkalemia despite otherwise normal renal function [7] who was further characterized by Stokes and colleagues [8] and Arnold and Healy [9] and shown to have low plasma renin. Following the report of a 10-year-old girl with short stature, hypertension, severe hyperkalemia, mild acidemia, periodic paralysis, and suppressed renin in 1970 by Gordon et al. [10], the syndrome has also occasionally been referred to as Gordon’s syndrome.
In 2001, mutations in the with-no-lysine (WNK) serine-threonine kinase genes WNK1 and WNK4 were identified as causes of PHA II [11], and further mutations in the KLHL3 (encoding kelch-like 3) and CUL3 (encoding cullin 3) genes were described in 2012 [12, 13]. PHA II subforms caused by mutations in WNK1, WNK4, and CUL3 are autosomal-dominant disorders, whereas KLHL3 mutations can be inherited either in an autosomal-dominant or in an autosomal-recessive fashion [12]. KLHL3 features an N-terminal BTB domain, followed by a BACK domain and a C-terminal six-bladed β-propeller structure consisting of so-called kelch-like repeats (shown in Fig. 1d,2a). Dominant KLHL3 mutations cluster in or between propeller blades, whereas recessive mutations are distributed throughout the protein [12]. Recessive cases are less common than dominant cases; in total, 21 patients from 14 families with recessive KLHL3 mutations have been published [12–15] (Table 1).
The underlying pathophysiology of hypertension in PHA II is increased NaCl reabsorption via the thiazide-sensitive carrier (Na-Cl cotransporter, NCCT) in the distal convoluted tubule of the kidney, and therapy with thiazides corrects both hypertension and electrolyte abnormalities in patients with PHA II [16]. In short, WNK1 and WNK4 phosphorylate OSR1 (oxidative stress-responsive gene 1) and SPAK (Ste20-related proline-alanine-rich kinase), which then phosphorylate and activate NCCT [17, 18]. KLHL3 is a substrate adapter of the ubiquitin ligase CUL3; the KLHL3-CUL3 complex ubiquitinylates WNK kinases and thus promotes their degradation [19]. Loss of ubiquitin ligase function or impaired binding to WNK kinases causes increased WNK abundance, increased NCCT phosphorylation [18], and increased NaCl absorption in the distal convoluted tubule. In later segments of the nephron, NaCl reabsorption via ENaC (epithelial sodium channel) and K+ secretion via ROMK (renal outer medullary potassium channel) are reduced [20, 21]. KLHL3 knockout mice show hypoplasia of the distal convoluted tubule, strongly increased levels of WNK1 and WNK4, and increased OSR1, SPAK, and NCC phosphorylation in the kidney. Further, they display hyperkalemia, hyperchloremia, and metabolic acidosis [22]. Here, we report a patient with autosomal-recessive PHA II and characterize the underlying genetic mutation and pathophysiology
Materials and Methods
DNA Preparation and Sanger Sequencing DNA was prepared from a peripheral venous blood sample using the QIAamp DNA Blood Maxi Kit (Qiagen) according to the manufacturer’s instructions. Standard PCR and direct bidirectional Sanger sequencing of genomic DNA were performed using published primers for KLHL3 [13], WNK1, and WNK4 [11], and the CUL3_9F (5′-AGGAGACACTTTCTCAAACCG-3′) and CUL3_9R (5′-TGTTCTTCTCCAAAACAATCTACC-3′) primers for CUL3. Sanger sequencing was performed at Eurofins Genomics.
Sequence Alignment
Homologous protein sequences were identified using NCBI Protein BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and the eggNOG database (http://eggnogdb.embl.de). Sequences shown include human KLHL3 and its orthologs: Homo sapiens (NP_059111.2), Mus musculus (NP_001349344.2), Gallus gallus (XP_015149442.1), Danio rerio (XP_021328460.1), Ciona intestinalis (XP_009862126.1), Drosophila melanogaster (NP_724095.1), and Caenorhabditis elegans (NP_001254310.1). Human paralogs were identified by literature research and include KLHL1 to KLHL42 as shown in online supplementary Table 1 (for all online suppl. material, see www.karger.com/doi/10.1159/000521626) [23]. Sequences were aligned using Jalview version 2.10.5 [24]. Domain structure was from UniProt (Q9UH77, accessed on April 13, 2021) and was visualized using DOG [25].
Plasmids and Site-Directed Mutagenesis
The pTRE2hyg WNK4 and pFN21A KLHL3 plasmids were kind gifts of Dr. Shinichi Uchida (Tokyo Medical and Dental University). To introduce the p.R431W mutation, primers were designed using Primer X (https://www.bioinformatics.org/primerx): 5′- GATGAACACGCGGTGGAGCAGTGTGG -3′ (KLHL3_ R431W_1F) and 5′- CCACACTGCTCCACCGCGTGTTCATC -3′ (KLHL3_R431W_1R). Mutant residues are shown in bold. Site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit with a PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions. The cDNA was Sanger-sequenced at Eurofins Genomics. Plasmids were prepared using the QIAGEN Plasmid Plus Maxi Kit.
Tissue Culture, Transient Transfection, and Western Blot
COS7 cells were cultured in DMEM + L-glutamine, 10% FBS, and 1% penicillin/streptomycin (all Gibco, Thermo Fisher). For transfections, cells were seeded on 6-well plates at a density of 1.9 × 105 cells/well and grown to approximately 90% density. Cells were transfected with 1 µg pTRE2hyg WNK4 and 2 µg pFN21A (empty vector or KLHL3 wild type [WT]) or KLHL3 R431W cDNA using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two independent clones each were used for transfection. Forty-eight hours after transfection, cells were washed in cold PBS and lysed in 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, and 1% NP40 containing complete Protease Inhibitor Cocktail (Roche, Merck). The lysate was centrifuged at 20,000 g for 30 min at 4°C, and the supernatant was stored at −20°C. Protein concentrations were determined in duplicates (standard) or triplicates (samples) by the BCA assay (Pierce, Thermo Fisher) according to the manufacturer’s instructions. About 20 µg total protein was fractionated by SDSPAGE and transferred to a PVDF membrane (1.5 h, 100 V). Membranes were blocked in 2% dry milk in TBST. Western blot was performed using polyclonal rabbit anti-HaloTag (Promega #G9281, 1:500, 4°C overnight), followed by washing and incubation with donkey IgG anti-rabbit IgG (H + L)-HRPO (Jackson ImmunoResearch # 711-035-152, dianova, 1:20,000, 1 h at room temperature), washing, and enhanced chemiluminescent detection (Amersham ECL Prime Western Blotting Detection Reagent, GE Healthcare). Blots were stripped using ROTIFree Stripping Buffer 2.0 (Carl Roth), blocked in 2% dry milk in TBST overnight at 4°C, and incubated with monoclonal mouse anti-FLAG M2 (SigmaAldrich #F1804, Merck, 1:1,000, 1.5 h at room temperature), followed by donkey IgG anti-mouse IgG (H + L)-HRPO (Jackson ImmunoResearch # 715-035-151, dianova, 1:20,000, 1 h at room temperature), ECL detection, stripping, and blocking as above. Blots were then incubated with monoclonal mouse anti-β-actin (Sigma-Aldrich # A2228, Merck, 1:5,000, 1 h at room temperature) and donkey IgG anti-mouse IgG, again followed by ECL detection. Bands were quantified using the Image Lab Software on a ChemiDoc XRS+ (Bio-Rad). Intensities of bands detected by the anti-HaloTag antibody and anti-FLAG M2 antibody, respectively, were divided by corresponding intensities of bands detected by anti-β- actin antibodies. To assess expression levels of KLHL3, cells were transfected as above however by using 0 µg, 0.5 µg, 1 µg, 2 µg, 4 µg, and 8 µg of pFN21A KLHL3 WT or R431W. Gel electrophoresis and blotting were performed as above. For the cycloheximide chase assay, cells were seeded as above and transfected as above however with 2 µg pFN21A KLHL3 WT or 4 µg KLHL3 R431W. Forty-eight hours after transfection, 100 µM cycloheximide was added, and cells were lysed after the indicated time points. Further analysis steps were as above.
Fig. 2. MD simulations of the WT and p.Arg431Trp (R431W) KLHL3 Kelch domains. a Top-down view of Kelch domain (PDBID: 4CH9), colored by β-propeller blades (K1–K6). The mutation site is indicated by a yellow star, and the region of interest is colored gray (residues 425–465), and the WNK4 peptide (not included in the simulations) is transparent and colored in gray. b Difference in the MSFs of the Kelch domain mapped on the protein backbone. The mutation site is indicated by a yellow star. The red color indicates more dynamic (less stable) parts of the protein. c RMSD of the whole protein (top), residues 425–465 (middle), and the WNK4-binding pocket (bottom) from the crystal structure for three independent simulation replicas (bold lines, running averages). d Violin plots of hbonds (left) and COM distance (middle) between K3 (residues 425–441) and K4 (442–465) β-propeller blades and binding-pocket electrostatics (right). e Structural overlay of the K3–K4 interface from the final frame (1.1 μs) of each replica (WT, blue; R431W, gray) with the experimental/initial models (black). The protein backbone is displayed as a cartoon, with residue 431 displayed as sticks. MSF, mean square fluctuation.
Molecular Dynamics Simulation
The WT model was based on the X-ray crystal structure (PDBID: 4CH9) of the human Kelch domain in complex with the WNK4 peptide fragment [26]. Missing atoms and terminal caps were added using the psfgen utility in visual molecular dynamics version 1.9.3 [27]. The mutant (R431W) KLHL3 model was generated using Modeller version 9.18 [28]. The final residue range for each system was 300–585. The N- and C-termini of the WT and R431W models were neutralized by acetylation and N-methylamidation, respectively. Default protonation states were assigned to each titratable residue according to analysis with PROPKA version 3.0 [29]. The WNK4 peptide was removed from production simulations due to dissociation from KLHL3 after initial equilibration simulations.
All simulations were conducted using the GROMACS software package version 2021 [30]. CHARMM36m force-field parameters were used for protein atoms [31]. Ions were described using default CHARMM parameters, and the TIP3P model was used for waters [32]. An integration time step of 1 fs was used for the initial equilibration step, with 2 fs being used for all subsequent simulations. All bonds involving hydrogen were constrained using LINCS [33]. Nonbonded Van der Waals interactions were calculated using the Lennard-Jones potential with a cutoff radius of 1.2 nm; forces were smoothly switched off in the range of 1.2–1.0 nm. All electrostatics were calculated using the smoothed particle-mesh Ewald [34] method with a real-space cutoff distance of 1.2 nm. Following an initial simulation in the isochoric-isothermal ensemble (NVT), all subsequent simulations were performed in the isobaric-isothermal ensemble (NPT) at a temperature of 310.15 K using the velocityrescaling thermostat [35] with a time constant of 0.5 ps. The thermostat was applied separately to the protein and solvent (i.e., water and ions); the same groups were used for the removal of center-of-mass (COM) motion. A pressure of 1 bar was imposed using either a Berendsen [36] or Parrinello-Rahman [37] barostat in an isotropic manner with a time constant of 5 ps.
The WT and R431W models were solvated in a cubic box with initial dimensions of 1.2 × 1.2 × 1.2 nm3 . Each system was neutralized with 150 mM NaCl. Following an initial steepest-descent energy minimization, each system was equilibrated in the NVT ensemble for 5 ns with position restraints on all protein atoms. A subsequent equilibration step was performed in the NPT ensemble for 5 ns with the same restraints as in the previous step. Position restraints were removed from all side chains for the final 5-ns equilibration simulation. Three initial structures were generated from the final stage of equilibration for independent production simulations of the WT and R431W systems with all position restraints removed. Each production replicate was simulated for 1.1 µs; the first 0.1 µs was removed from analysis.
To assess the structural stability over the course of the simulations, root mean squared deviations (RMSDs) from the crystal structure were calculated for the Cα atoms of the entire protein, as well as the K3–K4 interface (residues 425–465) and the WNK4- binding pocket (residues 339, 355, 360, 386, 402, 407, 432, 449, 451, 481, 498, 528, and 577). Running averages of the RMSD traces were calculated and overlaid with the raw data.
The effect of the mutation on structural stability was visualized by calculating the difference in the mean square fluctuations of the protein Cα atoms, averaged over frames and replicas and mapping to the WT protein structure. All protein visualizations were generated using ChimeraX [38]. The effect of the R431W mutation on the K3 (residues 425–441) to K4 (residues 442–465) interface was characterized by hydrogen bond (H-bond) analysis and COM distance between the two groups. H-bonds were assessed at each frame using the GROMACS tool gmx hbond, with distance and angle cutoffs of 3.5 Å and 30°, respectively. COM distances were similarly assessed at each frame – distributions of both the Hbonds and COM distances were visualized as violin plots. Averages were calculated over trajectories and replicas.
Electrostatics of the WNK4-binding pocket was calculated using g_elpot [39]. The time course of the electrostatic potential in the binding pocket was evaluated by defining a spherical volume with a radius of 8 Å, centered at the geometric center of the residues comprising the binding pocket. To evaluate the variance in the electrostatics, 50-ns block averages were calculated. The distribution of the electrostatic potential within the binding pocket for the WT and R431W mutant was visualized as violin plots, with averages calculated over 50-ns blocks and trajectories.
Supportive Service Of Wecistanche-The largest cistanche exporter in the China:
Email:wallence.suen@wecistanche.com
Whatsapp/Tel:+86 15292862950
Shop For More Specifications Details:
https://www.xjcistanche.com/cistanche-shop
