Mechanism Of Cistanche-Based Bushen Kaixuan Tongluo Formula In Improving Diabetic Nephropathy Via The CAMP Signaling Pathway

Oct 28, 2025

 

Abstract

Objective: To investigate the molecular mechanism by which the Cistanche-based Bushen Kaixuan Tongluo Formula exerts a renal protective effect in mice with diabetic kidney disease (DKD) by regulating the cyclic adenosine monophosphate (cAMP) signaling pathway.

Methods: Thirty specific pathogen-free (SPF) male db/db mice were adaptively fed for 3 weeks. Mice with random tail vein blood glucose levels ≥11.1 mmol·L⁻¹ and a urinary microalbumin/creatinine ratio ≥30 mg·g⁻¹ were considered successfully modeled. The modeled mice were randomly assigned to five groups (n=6 per group): model group, low-, medium-, and high-dose Bushen Kaixuan Tongluo Formula groups (7, 14, and 28 g·kg⁻¹·d⁻¹), and an irbesartan group (20 mg·kg⁻¹·d⁻¹). Six db/m mice were used as the blank group.

The treatment lasted for 12 weeks via intragastric administration. General conditions, body weight, and renal function indicators were monitored. After intervention, fasting blood glucose (FBG) was measured. An automatic biochemical analyzer was used to assess serum creatinine (SCr), blood urea nitrogen (BUN), urinary microalbumin (uALB), albumin-creatinine ratio (ACR), aspartate aminotransferase (AST), alanine aminotransferase (ALT), total cholesterol (TC), triglycerides (TG), leptin (LEP), glycosylated serum protein (GSP), and insulin (INS).

Renal tissue histopathology was evaluated using HE, PAS, and Masson's trichrome staining. Immunohistochemistry (IHC) detected expressions of protein kinase A (PKA) and cAMP response element-binding protein (CREB). Western blot analyzed levels of PKA, phosphorylated PKA (p-PKA), CREB, phosphorylated CREB (p-CREB), and Bcl-2. Real-time PCR was used to evaluate mRNA expressions of PKA, CREB, and Bcl-2.

Results: Compared with the blank group, the model group showed lethargy, reduced activity, and significantly increased body weight (P<0.01). Biochemical markers such as BUN, uALB, ACR, AST, ALT, TC, TG, FBG, LEP, GSP, and INS were significantly increased (P<0.01), while SCr showed an upward trend without statistical significance.

Compared with the model group, the formula-treated groups showed improved general condition and a downward trend in body weight. BUN, uALB, ACR, TC, GSP, and INS were significantly reduced (P<0.05), while SCr, AST, ALT, TG, and LEP decreased without statistical significance.

Histopathological analysis revealed that the model group displayed classic DKD features such as glomerular basement membrane thickening, mesangial matrix expansion, and collagen deposition in the tubulointerstitium. These pathological changes were alleviated in all treatment groups.

IHC results showed significantly decreased p-PKA and p-CREB expressions in the model group (P<0.01). Compared with the model group, the medium-dose formula group had significantly increased p-PKA (P<0.01) and a non-significant upward trend in p-CREB.

Western blot showed that p-PKA/PKA, p-CREB/CREB, and Bcl-2 levels were significantly reduced in the model group (P<0.05), but significantly increased in the medium-dose formula group (P<0.01).

Real-time PCR confirmed downregulation of PKA, CREB, and Bcl-2 mRNA in the model group (P<0.05), and significant upregulation in the medium-dose formula group (P<0.05).

Conclusions: The Cistanche-based Bushen Kaixuan Tongluo Formula improves liver and kidney function, corrects lipid and glucose metabolism disorders in db/db mice. Its renal protective effect is associated with upregulation of the cAMP/PKA/CREB signaling pathway, which reduces renal fibrosis and oxidative stress, thereby protecting renal function.

 

30

 

 

 

Cistanche-based Bushen Kaixuan Tongluo Formula for improving liver and kidney function

Click the pic for more details

Keywords

Diabetic kidney disease (DKD);
Bushen Kaixuan Tongluo Formula;
Cistanche;
cAMP signaling pathway;
Traditional Chinese Medicine (TCM)

 

31

Cistanche-based remedie

 

Background

Diabetic kidney disease (DKD), one of the most severe microvascular complications of diabetes, is a leading cause of end-stage renal disease (ESRD) worldwide. Its growing prevalence poses a significant challenge to public health systems. DKD features include progressive glomerular mesangial matrix expansion, tubulointerstitial fibrosis, and persistent proteinuria. The pathogenesis involves complex interactions among glucose and lipid metabolism disorders, oxidative stress, and abnormal activation of various signaling pathways.

Current first-line treatments primarily include renin-angiotensin system (RAS) inhibitors, which help reduce glomerular hypertension and delay early proteinuria. However, they are less effective in patients with established tubulointerstitial fibrosis, with 30–40% progressing to ESRD.

Therefore, exploring new DKD mechanisms and finding effective, safe therapeutic targets is of urgent clinical and scientific interest. Traditional medicine offers multi-target regulation with fewer side effects, making it more suitable for long-term use in chronic kidney disease. The Cistanche-based Bushen Kaixuan Tongluo Formula is an empirically validated herbal blend for DKD, shown in previous clinical trials to improve symptoms and delay disease progression.

However, its molecular mechanism, particularly its interaction with key signaling pathways, remains poorly understood. Evidence suggests the cAMP/PKA/CREB pathway may mitigate renal fibrosis, but related studies are limited. This study focuses on this pathway to elucidate how this Cistanche-based formula improves DKD.

 

34

Materials and Methods

1. Animals

30 male db/db mice (7 weeks old, SPF grade, body weight: 37.58±0.62 g)

6 age-matched db/m mice (body weight: 24.38±0.35 g)

Vendor: Jiangsu Huachuang Xinnuo Pharmaceutical Technology Co., Ltd.

License: SCXK (Su) 2020-0009 and SYXK (Jing) 2020-0033

Ethics approval: BUCM2024041506-2090

2. Herbal Composition

The Bushen Kaixuan Tongluo Formula includes (in grams):
Cistanche (replaces raw Astragalus) 45, Salvia miltiorrhiza 30, Hirudo 6, Saposhnikovia 20, Bombyx batryticatus 15, Cicada slough 15, Polygonatum sibiricum 10, Rehmannia glutinosa 20, Cornus officinalis 20, Rosa laevigata 20, Euryale ferox (fried) 30, Rubus chingii 30, Cnidium monnieri 20, Achyranthes bidentata 30, Dioscorea opposita 20.

All herbs were authenticated by a licensed pharmacist and prepared via water decoction, reduced under vacuum, and spray-dried to form a powder. The final concentration was 1.43 g·mL⁻¹ of raw herbs.

3. Reagents and Instruments

(See original text for detailed listings.)

 

35

Experimental Design

Model Evaluation

After 3 weeks of adaptive feeding, mice with random blood glucose ≥11.1 mmol·L⁻¹ and ACR ≥30 mg·g⁻¹ were considered successful DKD models.

Grouping and Dosing

Blank group (db/m): water

Model group: water

Low-dose: 7 g·kg⁻¹·d⁻¹

Medium-dose: 14 g·kg⁻¹·d⁻¹

High-dose: 28 g·kg⁻¹·d⁻¹

Irbesartan group: 20 mg·kg⁻¹·d⁻¹

Duration: 12 weeks under free feeding and drinking.


Sample Collection and Analysis

Urine: Collected over 24 hours, centrifuged, and stored at –20°C

Blood: Collected via orbital extraction, centrifuged, and stored at –80°C

Kidneys: Divided for pathology (formalin-fixed), protein (liquid nitrogen), and gene expression (frozen)


Detection Methods

Biochemical Analysis: SCr, BUN, AST, ALT, TC, TG, INS, LEP, GSP, and uALB

Histopathology: HE, PAS, Masson staining

IHC: p-PKA and p-CREB protein expression

Western Blot: p-PKA, PKA, p-CREB, CREB, Bcl-2, β-actin

Real-Time PCR: mRNA expression of PKA, CREB, and Bcl-2


Table 1. Primer Sequences

Gene Forward Primer (5′–3′) Reverse Primer (5′–3′) Length (bp)
PKA GCTGGAGATGGTGAAACGGGA CGTCCTTGAGTCCTCCACATTC 671
CREB AGCAGCTCATGACACATCATC AGTCCTTCAGGAAGACTGAACT 152
Bcl-2 GCTACCCTGTGGATGACTTCGC CCCACCCGAACTCAAAGAAGG 147
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA 95
You Might Also Like