Abstract

Objective To investigate the uric acid-lowering effect and safety evaluation of echinacoside (Ech) extracted from Cistanche tubulosa. Methods In the acute toxicity test, KM mice were orally administered Ech at the maximum concentration twice daily for acute toxicity observation. A hyperuricemia (HUA) rat model was established using 1.5 g·kg⁻¹ potassium oxonate + 0.1 g·kg⁻¹ adenine. HUA model rats were randomly divided into a model group, an allopurinol group (30 mg·kg⁻¹), and low-, medium-, and high-dose Ech groups (50, 75, 100 mg·kg⁻¹), with a normal control group (n=10 per group). Drugs were intragastrically administered once daily for 28 consecutive days. After administration, rats were sacrificed, and serum was collected to detect relevant biochemical indicators and xanthine oxidase (XOD) levels; renal histopathological changes were observed. Organs were weighed to calculate organ coefficients; the expression levels of related genes and proteins in renal tissue were detected. Results No obvious toxic reactions were observed in the acute toxicity test. Ech significantly reduced serum uric acid levels, markedly improved renal function and renal tubular/interstitial lesions in HUA model rats, and significantly regulated the transcription and protein expression levels of urate transporter-related genes in renal tissue. Conclusion The uric acid-lowering effect of Ech in HUA model rats may be related to reducing in vivo uric acid production, regulating renal function, and modulating the expression of urate transporters, with favorable safety.Keywords: Cistanche tubulosa; Echinacoside; Hyperuricemia; Uric acid; Gene transcription; Protein expression; Mechanism of action; Safety evaluation

 

 

 

Cistanche tubulosa (Schenk) R. Wight is a commonly used kidney-tonifying herb in traditional Chinese medicine (TCM). As recorded in the Chinese Pharmacopoeia, it replenishes kidney yang, replenishes essence and blood, and is clinically used for impotence and infertility, deficiency of essence and blood, and soreness of the waist and knees. Phenylethanoid glycosides are the most abundant and biologically active components in Cistanche tubulosa, showing great potential for development and application. Our research team previously found via network pharmacology and preliminary mouse experiments that echinacoside (Ech) from Cistanche tubulosa extract may exert uric acid-lowering effects, while its mechanism and safety are rarely reported. This study takes the pathogenesis of hyperuricemia as the entry point to examine the pharmacological uric acid-lowering effect of Ech, aiming to clarify its mechanism and evaluate its safety.

1 Materials and Methods

1.1 Instruments, Reagents and Animals

7100 Automatic Biochemical Analyzer (Hitachi, Japan); Multiskan GO 1510 Microplate Reader (Thermo, USA); BG-Power600i Electrophoresis System (Beijing Baijing Biotechnology Co., Ltd.); 7500 Fast Real-Time Fluorescent Quantitative PCR System (Applied Biosystems, USA).

Cistanche tubulosa extract (Ech, self-prepared, chromatographic purity >98%); potassium oxonate, adenine (Shanghai Aladdin Biochemical Technology Co., Ltd.); creatinine (CREA), uric acid (UA), urea (UREA), adenosine deaminase (ADA), alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP) assay kits (Shenzhen Mindray Bio-Medical Electronics Co., Ltd.); XOD activity assay kit (Shanghai Macklin Biochemical Technology Co., Ltd.); antibodies URAT1, GLUT9, OAT1, OAT3 (Jiangsu Qinke Biotechnology); goat anti-rabbit IgG/HRP conjugate (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Lot: 245440113); DEPC (Amresco, USA); M5 HiClear DL2000 DNA marker (Beijing Juhemai Biotechnology Co., Ltd.); TRIzol™ Reagent (Thermo Fisher Scientific, USA); 5× All-In-One RT MasterMix, EvaGreen Express 2× qPCR MasterMix-Low ROX (Aibimeng Biotechnology Co., Ltd.).

Forty SPF-grade KM mice (male and female, 18–22 g) and 90 SPF-grade male SD rats (150–180 g) were provided by the Experimental Animal Center of Xinjiang Medical University (production license No. SCXK Xin 2023-0001).

1.2 Methods and Results

1.2.1 Acute Toxicity Test

Animal experiments were approved by the Ethics Committee of Xinjiang Institute of Drug Research (approval Nos. IACUC-(Zhun)-2024-008, IACUC-(Zhun)-2024-009). Forty SPF-grade KM mice were randomly divided into a control group and a treatment group (n=20, male and female) after quarantine and acclimatization. Mice were fasted overnight with free access to water before administration. According to the Guidelines for Single-Dose Toxicity Testing of Traditional Chinese Medicines and Natural Products, the maximum concentration solution (250 mg·mL⁻¹) passable through a 12-gauge gavage needle was prepared. KM mice were orally administered 40 mL·kg⁻¹ twice daily at a 4-hour interval, with a cumulative dose of 20 g·kg⁻¹. General conditions, coat color, activity, gait, mental state, feces, and urine were closely observed for toxic symptoms, onset time, duration, and recovery. No adverse toxic reactions (e.g., restricted activity, prostration, listlessness, death) were observed in the treatment group. Coat color, activity, gait, mental state, feces, and urine remained normal during the observation period. Body weight and food intake showed no significant differences between the treatment and control groups. Gross necropsy at the end of observation revealed no abnormalities in organ volume, color, or texture.

 

Figure 1 Effects of Echo bodyweight(AB)andfoodintake(C,D)inmice

 

1.2.2 Model Establishment, Grouping, and Administration

Sixty male SD rats (150–180 g) were acclimatized and divided into a normal control group (n=10) and a modeling group (n=50). The modeling group was intragastrically administered 100 mg·kg⁻¹ adenine + 1.5 g·kg⁻¹ potassium oxonate (suspended in 0.5% CMC-Na) at 10 mL·kg⁻¹ once daily for 14 days; the control group received 0.5% CMC-Na. After modeling, orbital blood was collected to detect UREA, CREA, and serum uric acid (SUA). The model was considered successful when UREA, CREA, and SUA were significantly elevated. Successful HUA model rats were divided into a model group, allopurinol group (30 mg·kg⁻¹), and low-, medium-, and high-dose Ech groups (50, 75, 100 mg·kg⁻¹) (n=10 per group). To maintain stable hyperuricemia, all groups except the control group were intragastrically administered 100 mg·kg⁻¹ adenine + 500 mg·kg⁻¹ potassium oxonate (0.5% CMC-Na suspension) each morning, and corresponding drugs each afternoon for 14 days. Modeling agents were then stopped, while drug administration continued for another 14 days.

1.2.3 Determination of SUA and Urinary Uric Acid (UUA) in Rats

After the last administration, rats were fasted overnight with free access to water. Urine was collected, centrifuged (3×10³ r·min⁻¹, 10 min), diluted 1:9 with saline, and tested for UUA using a biochemical analyzer. Blood was collected under anesthesia, and serum was separated (3×10³ r·min⁻¹, 10 min) for SUA detection. Compared with the control group, the model group showed significantly increased SUA (P<0.05) and decreased UUA (P<0.01). The allopurinol group and low-, medium-, and high-dose Ech groups had significantly reduced SUA (P<0.05); the allopurinol group and medium-/high-dose Ech groups had significantly increased UUA (P<0.05 or P<0.01).

 

Figure 2 Effect Of Ech on SUA(A) and UUA(B) in hyperuricemia model rats

 

1.2.4 Determination of Serum ADA and XOD Levels in Rats

Serum ADA was measured using a biochemical analyzer; XOD activity was detected by enzyme-linked immunosorbent assay (absorbance at 290 nm). Compared with the normal group, the model group had significantly elevated ADA and XOD (P<0.01). Compared with the model group, the allopurinol group and all Ech dose groups had significantly reduced ADA (P<0.01); the allopurinol group and high-dose Ech group had significantly reduced XOD (P<0.01).

1.2.5 Determination of Serum UREA, CREA, ALT, AST, ALP Levels

Compared with the normal group, the model group had significantly elevated UREA and CREA (P<0.05 or P<0.01). Compared with the model group, the allopurinol group had significantly reduced UREA (P<0.01); all Ech dose groups had significantly reduced UREA and CREA (P<0.05 or P<0.01); medium-/high-dose Ech groups had significantly reduced ALT (P<0.01); low-dose Ech group had significantly increased ALP (P<0.01).

1.2.6 Determination of Renal Organ Coefficient in Rats

Organ coefficient = organ mass (mg)/body weight (g). Compared with the normal group, the model group had significantly decreased fasting body weight (P<0.01) and increased kidney and adrenal gland coefficients (P<0.05 or P<0.01). Compared with the model group, all Ech dose groups had significantly increased body weight (P<0.05); the allopurinol group and all Ech dose groups had significantly reduced kidney coefficients (P<0.01).

 

Table 1 Effects of Ech on UREA, CREA, ALT, AST and ALP Levels in Hyperuricemia Model Rats (xˉ±s, n=10)

 

Group	Dose / mg·kg⁻¹	UREA / mmol·L⁻¹	CREA / μmol·L⁻¹	ALT / U·L⁻¹	AST / U·L⁻¹	ALP / U·L⁻¹
Control	–	8.00 ± 0.71	34.11 ± 3.33	51.22 ± 3.80	109.11 ± 11.62	206.00 ± 42.20
Model	–	23.20 ± 6.05**	100.10 ± 43.59*	62.00 ± 9.64	109.10 ± 7.92	173.10 ± 27.30
Allopurinol	30	10.70 ± 1.95##	55.20 ± 13.27	52.70 ± 12.79	117.50 ± 21.71	198.40 ± 52.66
Ech	50	11.20 ± 3.33##	44.80 ± 21.01#	55.70 ± 12.59	106.10 ± 13.80	242.11 ± 55.04##
	75	9.90 ± 1.45##	41.20 ± 4.54#	46.50 ± 5.72##	102.10 ± 16.11	183.70 ± 22.31
	100	8.90 ± 1.10##	35.20 ± 2.74#	46.50 ± 5.72##	106.00 ± 15.19	195.20 ± 33.96

Note: Compared with control group: *P<0.05, **P<0.01; compared with model group: #P<0.05, ##P<0.01

 

Table 2 Effects of Ech on Organ Coefficients in Hyperuricemia Model Rats (xˉ±s, n=10)

 

Group	Dose / mg·kg⁻¹	Fasting Body Weight / g	Liver Coefficient	Kidney Coefficient	Adrenal Gland Coefficient	Spleen Coefficient	Thymus Coefficient
Control	–	403.6 ± 28.0	26.92 ± 3.15	6.57 ± 0.55	0.14 ± 0.04	1.88 ± 0.26	1.07 ± 0.15
Model	–	352.5 ± 38.5**	26.60 ± 1.78	11.52 ± 1.67**	0.18 ± 0.03*	2.12 ± 0.23	1.03 ± 0.17
Allopurinol	30	367.5 ± 26.3	25.76 ± 1.14	7.93 ± 0.51##	0.16 ± 0.03	1.93 ± 0.35	1.08 ± 0.27
Ech	50	392.3 ± 28.3#	27.04 ± 2.14	8.06 ± 0.54##	0.16 ± 0.04	2.09 ± 0.24	1.09 ± 0.19
	75	388.4 ± 34.8#	26.78 ± 2.37	7.80 ± 0.78##	0.16 ± 0.02	2.00 ± 0.20	0.99 ± 0.25
	100	386.3 ± 41.4#	25.91 ± 1.46	7.58 ± 0.33##	0.18 ± 0.03	2.09 ± 0.28	1.17 ± 0.31

Note: Compared with control group: *P<0.05, **P<0.01; compared with model group: #P<0.05, ##P<0.01

 

 

 

1.2.7 Histopathological Observation of Rat Kidney (HE Staining)

Kidney tissues were fixed, dehydrated, embedded, sectioned (4 μm), stained with HE, and sealed. The model group showed renal tubular epithelial cell shedding, necrotic and inflammatory cell infiltration, and focal inflammatory infiltration in the renal interstitium. The allopurinol group showed mild lesions; Ech treatment groups showed alleviated epithelial cell shedding, necrosis, and inflammatory infiltration.

 

 

Figure4 HEstainingimageofratkidneytissueofcontrolgroup(A),modelgroup(B),allopurinolgroup(C,D),low(E)andhigh
(F)dosegroupsofEch(×400)

 

1.2.8 Protein Expression of URAT1, GLUT9, OAT1, OAT3 in Rat Kidney

Immunohistochemistry was performed to detect protein expression (integrated optical density, IOD). Compared with the normal group, the model group had significantly upregulated URAT1 and GLUT9 (P<0.01) and downregulated OAT1 and OAT3 (P<0.05). Compared with the model group, the allopurinol group and all Ech dose groups had significantly downregulated URAT1 and GLUT9 (P<0.05, P<0.01) and upregulated OAT1 (P<0.05, P<0.01); the allopurinol group and medium-/high-dose Ech groups had significantly upregulated OAT3 (P<0.05, P<0.01).

 

Figure5 EffectsofEchonURAT1/IODvalues(A),GLUT9/IODvalues(B),OAT1/IODvalues(C),andOAT3/IODvalues(D)in
renaltissueofhyperuricemiamodelrats

 

Figure 6 Effects of Ech on renal URAT1 expression in hyperuricemia model rats

(Control group (A), model group (B), allopurinol group (C), and 50, 75, 100 mg·kg⁻¹ Ech groups (D–F); IHC ×400)

 

Figure 7 Effects of Ech on renal GLUT9 expression in hyperuricemia model rats

(Control group (A), model group (B), allopurinol group (C), and 50, 75, 100 mg·kg⁻¹ Ech groups (D–F); IHC ×400)

Figure 8 Effects of Ech on renal OAT3 expression in hyperuricemia model rats

(Control group (A), model group (B), allopurinol group (C), and 50, 75, 100 mg·kg⁻¹ Ech groups (D–F); IHC ×400)

Figure 9 Effects of Ech on renal OAT1 expression in hyperuricemia model rats

(Control group (A), model group (B), allopurinol group (C), and 50, 75, 100 mg·kg⁻¹ Ech groups (D–F); IHC ×400)

 

 

1.2.9 mRNA Expression of URAT1, GLUT9, OAT1, OAT3 in Rat Kidney

Total RNA was extracted and reverse-transcribed; qPCR was performed using the 2⁻ΔΔCt method. Compared with the normal group, the model group had significantly upregulated URAT1 and GLUT9 mRNA (P<0.05) and downregulated OAT1 and OAT3 mRNA (P<0.05). Compared with the model group, the allopurinol group and all Ech dose groups had significantly downregulated URAT1 mRNA (P<0.05); the allopurinol group and low-/medium-dose Ech groups had significantly downregulated GLUT9 mRNA (P<0.05); the allopurinol group and all Ech dose groups had significantly upregulated OAT1 and OAT3 mRNA (P<0.05).

 

Table 3 Primer sequences

 

Primer name	Sequence (5′ to 3′)	Product size
URAT1-β	F: GTTCCCATGGCCTCCAGATTR: CATATGCATGCCACACAGCC	121 bp
GLUT9	F: TCTGCCTTGGCTGAGTATTGAR: ATGTGTCCCCCACATCATTGT	2147 bp
OAT1	F: TGTGAAGCCCTTCCGTTCTCR: TGTGAAGCCCTTCCGTTCTC	218 bp
OAT3	F: TACCTGCATGTGACCTTGCTGR: GAGACACTTCTCAGGCTTCCC	171 bp
β-Actin	F: CCCATCTATGAGGGTTACGCR: TTTAATGTCACGCACGATTTC	150 bp

 

1.2.10 Statistical Analysis

Data were analyzed using SPSS 20.0, expressed as mean ± standard deviation (x̄±s). One-way ANOVA was used for group comparisons, and LSD or Tamhane's T2 for post-hoc tests. P<0.05 was considered statistically significant.

Figure5 EffectsofEchonURAT1/IODvalues(A),GLUT9/IODvalues(B),OAT1/IODvalues(C),andOAT3/IODvalues(D)in renaltissueofhyperuricemiamodelrats

 

2 Discussion

Persistent hyperuricemia causes uric acid-induced renal injury and alters renal function biomarkers. This study established a HUA rat model using adenine combined with potassium oxonate, with UREA, CREA, and SUA as key indicators. Results showed that Ech from Cistanche tubulosa improved renal function and reduced SUA in HUA model rats, exerting therapeutic effects. Hyperuricemia arises from excessive uric acid production and impaired excretion. Hepatic XOD and ADA are key enzymes in uric acid synthesis; overproduction is a major cause of HUA. Approximately two-thirds of daily uric acid is excreted via the kidneys, making renal excretion dysfunction a primary driver. URAT1 and GLUT9 mediate uric acid reabsorption, while OAT1 and OAT3 facilitate uric acid excretion-all are key targets for uric acid-lowering drug development. Ech significantly reduced hepatic ADA and XOD, downregulated renal URAT1/GLUT9 (protein and mRNA), and upregulated OAT1/OAT3 (protein and mRNA), indicating its uric acid-lowering effect acts through reducing synthesis and regulating transporters. In acute toxicity testing, no mortality or obvious acute toxicity was observed in mice. Ech improved renal function and lowered hepatic ALT in HUA rats without affecting AST or organ coefficients, confirming favorable safety. In conclusion, Ech exerts significant uric acid-lowering effects in adenine–potassium oxonate-induced HUA rats by suppressing ADA/XOD-mediated uric acid synthesis, protecting renal function, and balancing urate transporter expression, with reliable safety for potential clinical application.

References

Zhang MH, Du JW, Zhang T, et al. Mechanism of Bixie Fenqing Wan in intervention of hyperuricemia rats by regulating urate transporter expression[J]. Chinese Journal of Experimental Traditional Medical Formulae, 2023, 29(3): 1–8.

Niu YF, Zhou YF, Lin H, et al. Inhibition of 3,5,2′,4′-tetrahydroxychalcone on production of uric acid in hypoxanthine-induced hyperuricemic mice[J]. Biological & Pharmaceutical Bulletin, 2018, 41(1): 99–105.

Frédéric L. Gout: an update[J]. Journal of Bone and Joint Surgery, 2019, 86(1): 103–115.

Takeo N, Kouhei O, Sho S, et al. Functional cooperation of URAT1 (SLC22A12) and URATv1 (SLC2A9) in renal reabsorption of urate[J]. Nephrology Dialysis Transplantation, 2013, 28(3): 603–611.

Lee SY, Cho SS, Han KM, et al. Korean red ginseng ameliorates serum uric acid levels via downregulating URAT1 and upregulating OAT1 and OAT3[J]. Biological & Pharmaceutical Bulletin, 2024, 47(11): 1876–1882.

Falah K, Zhang P, Nigam AK, et al. In vivo regulation of small molecule natural products, antioxidants, and nutrients by OAT1 and OAT3[J]. Nutrients, 2024, 16(14): 2242.

 

High-Content Cistanche Supply Source for Uric Acid-Lowering Herbs

For institutions, practitioners, and individuals focused on herbal therapies for reducing uric acid and hyperuricemia management, high-purity Cistanche tubulosa extract is a reliable natural raw material with verified efficacy.

Core Advantages of the Supply Source

High Standardized Active Components

Echinacoside (Ech): ≥10%–40%

Acteoside: ≥4%–16%

Total Phenylethanoid Glycosides: ≥40%–85%(Meets food-grade and extract-grade specifications for R&D and product development)

 

Cistanche Base and Factory

Contact now

 

Supportive Service Of Wecistanche-For more details about cooperation
Email:wallence.suen@wecistanche.com

 

Verified Uric Acid-Lowering Mechanism

Inhibits XOD/ADA to reduce uric acid synthesis

Regulates URAT1/GLUT9/OAT1/OAT3 to promote uric acid excretion

Protects renal function and alleviates hyperuricemia-related renal injury

Safe & Well-Tolerated

Acute toxicity test: No obvious adverse reactions at high doses

No significant damage to liver, kidney, or major organs

Compliant with food and dietary supplement requirements

Authoritative Supply Link

https://www.xjcistanche.com/cistanche-extract-product/herbal-cistanche-dietary-supplement-capsules.html

 

This source provides standardized Cistanche tubulosa extract, capsules, tablets, oral liquids, and custom processing services, supporting herbal uric acid-lowering product development, clinical research, and dietary supplement formulation.