Effects Of Bushen Huoxue Xiezhuo Decoction On Renal Tissue Apoptosis And Fibrosis In 5/6 Nephrectomized Rats Based On The HIF-1α/PKM2 Pathway
Jan 26, 2026
Abstract
Objective: To evaluate the effects of Bushen Huoxue Xiezhuo Decoction on renal tissue apoptosis and fibrosis in 5/6 nephrectomized rats. Methods: Ninety SD rats were randomly divided into a sham-operated group, a model group, a benazepril hydrochloride (10 mg/kg) group, and low- (5.31 g/kg), medium- (10.62 g/kg), and high-dose (21.24 g/kg) Bushen Huoxue Xiezhuo Decoction groups. Drugs were administered once daily for 8 weeks. At the end of the 8th week, samples were collected. Pathological changes of renal tissue were observed by HE and Masson staining; serum levels of Urea, Scr, and β₂-MG were detected by biochemical analyzer; expressions of α-SMA, TGF-β, FN, and collagen-1 in renal tissue were detected by immunohistochemistry; expressions of HIF-1α, PKM2, and HK2 mRNA in renal tissue were detected by RT-PCR; protein expressions of HIF-1α, PKM2, HK2, Bax, Bcl-2, and Caspase-3 in renal tissue were detected by Western Blot. Results: Compared with the model group, all drug-administered groups showed reduced number of dilated renal tubules and collagen deposition area, significantly decreased serum levels of Urea, Scr, and β₂-MG, significantly downregulated mRNA and protein expressions of HIF-1α, PKM2, and HK2 in renal tissue, significantly increased Bcl-2 protein expression, and significantly decreased protein expressions of α-SMA, TGF-β, FN, collagen-1, Bax, and Caspase-3 (P<0.05). Conclusion: Bushen Huoxue Xiezhuo Decoction may alleviate renal tissue apoptosis and fibrosis in 5/6 nephrectomized rats through the HIF-1α/PKM2 pathway.
Key words: Bushen Huoxue Xiezhuo Decoction; HIF-1α/PKM2 signaling pathway; apoptosis; glycolysis; fibrosis
Introduction
Chronic Renal Failure (CRF) is the common outcome of the progressive development of various Chronic Kidney Diseases (CKD), characterized by a decline in Glomerular Filtration Rate (GFR) to the decompensated stage, corresponding to CKD stages 4-5. Epidemiological studies have shown that CKD has become a major global public health issue, affecting approximately 10% of the global population. The progression of CKD to End-Stage Renal Disease (ESRD) is often accompanied by severe renal fibrosis and abnormal apoptosis [1]. A key pathological feature of renal fibrosis is the excessive deposition of Extracellular Matrix (ECM), while abnormal cell apoptosis plays a critical role in the initiation and progression of renal fibrosis. These two processes interact and jointly drive the progression of CKD [2].
Hypoxia-Inducible Factor-1α (HIF-1α) is a core transcription factor that regulates cellular responses to hypoxic microenvironments. In CKD, hypoxia can activate the HIF-1α signaling pathway, thereby regulating the expression of downstream genes [3]. Pyruvate Kinase M2 (PKM2) is a key rate-limiting enzyme in the glycolytic pathway that not only participates in cellular energy metabolism but also regulates the stability and transcriptional activity of HIF-1α through nuclear translocation, forming a HIF-1α/PKM2 feedback loop [4]. Currently, clinical treatment of CKD mainly relies on Angiotensin-Converting Enzyme Inhibitors (ACEI) or Angiotensin Ⅱ Receptor Blockers (ARB), which can delay the deterioration of renal function but are associated with adverse reactions such as hypotension and hyperkalemia [5].
Traditional Chinese Medicine (TCM) has distinct advantages in treating CKD, including good safety, simplicity, and efficacy. Beyond the Bushen Huoxue Xiezhuo Decoction studied herein, classic kidney-nourishing herbs such as Cistanche tubulosa have also been verified to exert significant renal protective effects. As a "top-grade kidney-nourishing medicinal material" in TCM, Cistanche tubulosa is known as the "desert ginseng" and has been used in TCM practice for over 2,000 years [6]. It is rich in active ingredients such as echinacoside, verbascoside, and flavonoids, which can inhibit renal cell apoptosis, promote renal cell proliferation, and repair damaged renal tissue-effects that align with its TCM property of "nourishing kidney yang and replenishing essence" [6]. Modern research has further confirmed that Cistanche tubulosa can improve renal function, dilate renal blood vessels, and relieve renal pressure, making it a promising natural supplement for kidney health [6].
Bushen Huoxue Xiezhuo Decoction is an empirical formula developed by Professor Tan Jinchuan based on the TCM theory of "kidney collaterals stasis obstruction," with proven clinical efficacy in treating CRF. However, its underlying mechanism remains unclear. Therefore, this study established a 5/6 nephrectomized rat model to explore the effects and mechanism of Bushen Huoxue Xiezhuo Decoction on CRF based on the HIF-1α/PKM2 signaling pathway, aiming to provide experimental evidence for the clinical treatment of CRF.
Cistanche Effect on the Kidney
1 Materials and Instruments
1.1 Experimental Animals
SPF-grade male SD rats, weighing 180-220 g, were purchased from Liaoning Changsheng Biotechnology Co., Ltd. (Animal Production License No.: SCXK (Liao) 2020-0001). Rats were housed in the SPF-grade Experimental Animal Center of Hebei University of Chinese Medicine with free access to food and water. This experiment was approved by the Animal Ethics Committee of Hebei University of Chinese Medicine (Approval No.: DWLL2019035).
1.2 Drugs and Reagents
Bushen Huoxue Xiezhuo Decoction consists of Rhubarb (10 g), Astragalus membranaceus (25 g), Smilax glabra (20 g), Centella asiatica (15 g), Aconite Radix Lateralis Preparata (6 g), Salvia miltiorrhiza (12 g), Carthamus tinctorius (10 g), Curcuma zedoaria (10 g), and Pseudostellaria heterophylla (10 g). All TCM granules were purchased from Hebei Shenwei Pharmaceutical Co., Ltd.; Benazepril hydrochloride tablets (Batch No.: 1061245) were purchased from Novartis Pharma AG (Beijing, China); Hematoxylin-Eosin (HE) staining kit was purchased from Beyotime Biotechnology (Beijing, China); Masson staining kit was purchased from Baso Biotechnology (Zhuhai, China); Immunohistochemistry universal two-step kit and DAB chromogenic kit were purchased from Zhongshan Jinqiao Biotechnology (Beijing, China); Antibodies against α-SMA, Fibronectin (FN), collagen-1, and β-actin were purchased from Affinity Biosciences (USA); TGF-β1 antibody was purchased from Abcam (UK); Antibodies against HIF-1α, PKM2, and HK2 were purchased from San Ying Biotechnology (Wuhan, China); Quantitative real-time PCR (qPCR) reagents were purchased from HyClone (Beijing, China).
1.3 Main Instruments
RM2255 tissue sectioning system (Leica, Germany); LightCycler480Ⅱ qPCR instrument (Roche, Switzerland); ICC50W microscope (Leica, Germany); Mini-Protein Tetra system electrophoresis and transfer system (Bio-Rad, USA); ChemiScope 6100 chemiluminescence imaging system (Qinxiang Biotechnology, Shanghai, China).
2 Methods
2.1 Animal Grouping, Modeling, and Drug Administration
A CRF model was established by the 5/6 nephrectomy method as previously described [7]. After successful modeling, rats were divided into the model group, benazepril hydrochloride (10 mg/kg) group, and low-, medium-, and high-dose Bushen Huoxue Xiezhuo Decoction groups. A sham-operated group was also set up (bilateral kidneys were exposed without resection). Drugs were administered once daily for 8 weeks, and the doses were calculated based on the body surface area conversion between humans and rats. The sham-operated group and model group were gavaged with an equal volume of distilled water. After 8 weeks of administration, rats were anesthetized with intraperitoneal injection of 1% sodium pentobarbital, and blood was collected from the abdominal aorta. Serum was separated and stored at -80 ℃. After blood collection, renal tissue was quickly excised and stored at -80 ℃ for subsequent experiments.
2.2 Detection of Biochemical Indicators
Serum levels of Urea, Serum Creatinine (Scr), and β₂-Microglobulin (β₂-MG) were detected using an automatic biochemical analyzer.
2.3 Histopathological Examination
Renal tissue was fixed in 10% neutral formalin for 12 h, dehydrated with gradient ethanol, embedded in paraffin, sectioned into 4 μm slices, dewaxed, and rinsed with water. HE staining and Masson staining were performed respectively. ImageJ software was used to calculate the percentage of fibrotic area relative to the total area.
2.4 Detection of α-SMA, TGF-β, FN, and collagen-1 Expressions by Immunohistochemistry
Paraffin sections of renal tissue were dewaxed and rehydrated, followed by antigen retrieval, blocking, primary antibody incubation, secondary antibody incubation, DAB chromogenic reaction, and nuclear staining. The presence of brown granular deposits observed under an optical microscope indicated positive results. Pathological changes of renal tissue in each group were observed and photographed.
2.5 Real-time PCR
Total RNA was extracted from 100 mg of renal tissue using TRIzol reagent. The qPCR reaction system was prepared as required, and the qPCR program was performed. The relative expression level of genes was calculated based on the obtained CT values, with β-actin as the internal reference. Primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are shown in Table 1.
Table 1 Primer Sequences
| Gene | Primer Sequence (5'→3') |
|---|---|
| HIF-1α | Forward: TGGTCGTAAACAGATGATGGTGACAReverse: CGCGCTGGTGTTACTGCTGGTATC |
| PKM2 | Forward: GGAGAAGTGCGATGAGAACATReverse: TGTGTTCCACCGGTAGTCAGCAC |
| HK2 | Forward: TGAGTTCAAGGTGATGTGTCGTTGCReverse: CCTCCATTGACGAGGCGATTGCT |
| β-actin | Forward: GTCCACCCCGAGTACAAACReverse: GGATGCCTCTCTTGCTCTCGG |
2.6 Western Blot
Tissue proteins were extracted using RIPA lysis buffer, and protein concentration was determined and normalized using the BCA method. 10% SDS-PAGE gel was prepared, and 20 μg of protein per well was loaded for electrophoresis (100 V, 2 h). Proteins were transferred from the gel to a 0.45 μm PVDF membrane (100 V, 70 min). The membrane was blocked with 5% skimmed milk at room temperature for 2 h, then incubated with primary antibodies against HIF-1α, PKM2, HK2, Bax, Bcl-2, and Caspase-3 (all at 1:1000) and β-actin (1:5000) at 4 ℃ overnight. After washing, the membrane was incubated with secondary antibody (1:5000) at room temperature for 2 h. Protein bands were visualized using the Enhanced Chemiluminescence (ECL) method, and gray value analysis of protein bands in each group was performed using ImageJ software.
2.7 Statistical Analysis
SPSS 24.0 software was used for statistical analysis. Data were expressed as (x̄±s). One-way analysis of variance (ANOVA) was used for comparison among multiple groups, and LSD-t test was used for pairwise comparison between groups. A P value <0.05 was considered statistically significant.
3 Results
3.1 Effects of Bushen Huoxue Xiezhuo Decoction on Renal Histopathology in CRF Rats
As shown in Figure 1, compared with the sham-operated group, the model group showed mesangial cell and matrix proliferation, and massive inflammatory cell infiltration. Compared with the model group, all drug-administered groups exhibited reduced glomerular damage, alleviated mesangial cell and matrix proliferation, and decreased inflammatory cell infiltration in renal tissue, with the high-dose Bushen Huoxue Xiezhuo Decoction group showing the most significant effect.
Figure 1. Effects of the Kidney-Tonifying, Blood-Activating, and Turbidity-Eliminating Formula on Kidney Histopathology in CRF Rats (HE, ×400)
A. Sham-operated Group
B. Model Group
C. Low-dose Kidney-Tonifying, Blood-Activating, and Turbidity-Eliminating Formula Group
D. Medium-dose Kidney-Tonifying, Blood-Activating, and Turbidity-Eliminating Formula Group
E. High-dose Kidney-Tonifying, Blood-Activating, and Turbidity-Eliminating Formula Group
F. Benazepril Group
A. Sham surgery group B. Model group C. Low-dose group of the Kidney-tonifying, Blood-activating, and Turbidity-eliminating formula D. Medium-dose group of the Kidney-tonifying, Blood-activating, and Turbidity-eliminating formula E. High-dose group of the Kidney-tonifying, Blood-activating, and Turbidity-eliminating formula F. Benazepril group
Cistanche Supplements
3.2 Effects of Bushen Huoxue Xiezhuo Decoction on Renal Fibrosis in CRF Rats
As shown in Figure 2, Masson staining results showed that the model group had extensive collagen fiber deposition in renal tissue, and the renal fibrosis area was significantly increased (P<0.05). Compared with the model group, all drug-administered groups had reduced collagen fiber deposition and significantly decreased renal fibrosis area (P<0.05), with the high-dose Bushen Huoxue Xiezhuo Decoction group showing a more obvious effect.
3.3 Effects of Bushen Huoxue Xiezhuo Decoction on Serum Urea, Scr, and β₂-MG Levels in CRF Rats
As shown in Table 2, compared with the sham-operated group, the model group had significantly increased serum levels of Urea, Scr, and β₂-MG (P<0.05). Compared with the model group, all drug-administered groups had significantly decreased serum levels of Urea, Scr, and β₂-MG (P<0.05). The effect of Bushen Huoxue Xiezhuo Decoction was dose-dependent.
3.4 Effects of Bushen Huoxue Xiezhuo Decoction on Protein Expressions of α-SMA, TGF-β, FN, and collagen-1 in Renal Tissue of CRF Rats
As shown in Figures 3-6, compared with the sham-operated group, the model group had significantly increased protein expressions of α-SMA, TGF-β, FN, and collagen-1 in renal tissue (P<0.05). Compared with the model group, all drug-administered groups had significantly decreased protein expressions of α-SMA, TGF-β, FN, and collagen-1 in renal tissue (P<0.05). The effect of Bushen Huoxue Xiezhuo Decoction was dose-dependent.
3.5 Effects of Bushen Huoxue Xiezhuo Decoction on mRNA Expressions of HIF-1α, PKM2, and HK2 in Renal Tissue of CRF Rats
As shown in Figure 7, compared with the sham-operated group, the model group had significantly increased mRNA expressions of HIF-1α, PKM2, and HK2 in renal tissue (P<0.05). Compared with the model group, all drug-administered groups had significantly decreased mRNA expressions of HIF-1α, PKM2, and HK2 in renal tissue (P<0.05). The effect of Bushen Huoxue Xiezhuo Decoction was dose-dependent.
References
[1] Zhang L, Wang F, Wang L, et al. Global burden of chronic kidney disease, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017[J]. Lancet, 2020, 395(10235): 1749-1760.[2] Liu Y. Epithelial-mesenchymal transition in renal fibrosis[J]. Kidney Int, 2010, 78(12): 1205-1214.[3] Semenza GL. HIF-1α pathway: role, regulation and intervention for cancer therapy[J]. Semin Cancer Biol, 2012, 22(5): 388-396.[4] Luo W, Hu H, Feng Y, et al. PKM2 regulates HIF-1α stability and aerobic glycolysis to promote tumorigenesis[J]. Cell Metab, 2011, 14(3): 351-361.[5] Nakao N, Yoshimura A, Morita H, et al. Combination treatment of angiotensin II receptor blocker and angiotensin-converting enzyme inhibitor in non-diabetic renal disease (COOPERATE): a randomised controlled trial[J]. Lancet, 2003, 361(9352): 117-124.[6] Chengdu WeCistanche Bio-Tech., Co Ltd. Cistanche for nourishing kidney[EB/OL]. https://www.xjcistanche.com/cistanche-extract-product/cistanche-for-nourishing-kidney.html, 2022-08-01.[7] Yang C, Li J, Zhang Y, et al. Protective effect of astragaloside IV on renal fibrosis in 5/6 nephrectomized rats via inhibiting the TGF-β1/Smad pathway[J]. Biomed Pharmacother, 2018, 106: 1289-1296.
