Estrogenic Activity Of Glycosides From Cistanche Deserticola As An Estrogen Receptors Adjuvant in Vitro

Apr 03, 2024

INTRODUCTION 

Cistanche deserticola  ("Rou Cong Rong" in Chinese), a traditional Chinese herb medicine which first recorded in ShenNongBenCaoJing, has been used for the treatment of kidney deficiency, impotence, senile constipation, and blood deficiency for thousands of years.[1] It is mainly distributed in desert regions of Northwestern China, such as Gansu and Xinjiang.[2]Modern pharmacology research demonstrated that C. deserticola can advance broad medicinal functions, such as hormone regulation, immunomodulatory, antioxidative, neuroprotective, anti‑inflammatory, and estrogenic activity.[3,4] Glycosides of Cistanches  (GCs) were considered as one of the main active components with various biological effects.

Estrogen receptors‑α (ERs‑α) and ERβ are the subtypes of the ERs which could regulate physiological functions.[7] These proteins could regulate the transcription of target genes by binding to associated DNA regulatory sequences in the cell nucleus. Both of the subtypes are markedly expressed in the cardiovascular and central nervous systems.[8,9] ERα exists mainly in the mammary gland, uterus, ovary, bone, male reproductive organ, and prostate. ERβ is present mainly in the prostate, ovary, and bladder.[10,11] Moreover, there are some common physiological roles for the two subtypes, such as in the development and function of the ovaries and the protection of the cardiovascular system.[12,13] Previous research in our group revealed the estrogenic‑like mechanism of GCs by the method of metabolomic analysis.[14] In a continuous study, we analyzed the mechanism of estrogenic activity of GCs on MCF‑7 cell lines related to ERs.

Cistanche extract

NATURAL CISTANCHE TUBULOSA FOR IMPROVING ESTROGENIC ACTIVITY PHGS75% ECH 30% ACT 12%

MATERIALS AND METHODS 

Instruments 

ECO‑170P‑230 incubator was from New Brunswick Scientific (China) Co., Ltd., Bio‑Rad 680 microplate reader and electrophoresis apparatus were from Bio‑Rad Laboratories, Inc., CX21 microscope was from Olympus Co., Ltd., GIS‑2019 gel imaging system was from Tanon Science and Technology Co., Ltd., the flat bottom plate was from Corning Inc., EPICS‑XL flow cytometry was from Beckman‑Coulter Inc., and StepOnePlus Real‑Time polymerase chain reaction  (PCR) system was from Thermo Fisher Scientific. 

Chemicals and reagents 

GCs were prepared in our laboratory as the method previously reported,[14] and the purity of GCs was determined to be 52% (acteoside was used as a marker to determine the GCs) by ultraviolet spectrophotometry. Estradiol  (E2 ) was purchased from Yuanye Biotechnology Co., Ltd.  (Shanghai, China). Fetal bovine serum  (FBS) and RPMI‑1640 were from Gibco Co., Ltd., 96‑well flat bottom plate was from Corning Inc., and dimethyl sulfoxide  (DMSO) and 3‑[4,5‑dimethyl‑2‑thiazolyl]‑2,5‑diphenyltetrazolium bromide  (MTT) were purchased from Sigma‑Aldrich Corporation. TRIzol reagent, Reverse Transcription  (RT) Kit, and TB Green™ RT‑PCR Kit were purchased from TaKaRa Co., Ltd., Dalian, China. Anti‑ERα Rabbit pAb, anti‑ERβ Rabbit pAb, and β‑actin antibodies were purchased from Wanlei Biotechnology Co., Ltd. All the other common chemicals were purchased from standard commercial suppliers. 

Sample preparation 

Preparation of glycosides of Cistanches stock solution 

GC extract was dissolved in DMSO to make a stock solution with a concentration of 0.1051  g/ml and stored at 4°C. Phenol red‑free RPMI‑1640 was used to dilute the stock solution to various concentrations before use. 

Preparation of estradiol stock solution 

E2 extract was dissolved in DMSO to make a stock solution with a concentration of 0.27  mg/ml and stored at 4°C. Phenol red‑free RPMI‑1640 was used to dilute the stock solution to various concentrations before use. 

Preparation of charcoal dextran treated‑fetal bovine serum 

A hundred milliliters of FBS was mixed with 250 mg of activated charcoal powder and 25 mg of dextran. After incubating for 45 min at 55°C, the mixture was centrifuged at 4°C, 1000 rpm for 15 min. The supernatant was filtered using Millipore Express PES membrane to get the charcoal dextran‑treated (CDT)‑FBS and stored at −20°C. 

Cell culture 

The human breast cancer MCF‑7 cell lines were obtained from the American type culture collection  (ATCC). Moreover, the cells were cultured with RPMI‑1640 medium containing 10% FBS and 1% penicillin-streptomycin at 37°C under a humidified 5% CO2 atmosphere. Cells were cultured in the phenol red‑free RPMI‑1640 medium containing 5% CDT‑FBS 4 days before MTT assay so that the estrogen in the cells could be cleared. 

Cell proliferation analysis of estradiol on MCF-7 cell lines 

Cell proliferation was measured using the MTT assay for MCF‑7 cells.[15,16] E2 was dissolved in RPMI‑1640 culture media containing 0.1% DMSO at final concentrations of 0.1, 1, 10, 100, and 1000 nM. MCF‑7 cell lines were cultured in phenol red‑free RPMI‑1640 medium for 4 days. After washing with phosphate‑buffered saline (PBS) three times, 100 µL of FBS‑free RPMI‑1640 medium was added into 96‑well plates at 1.5 × 104 per well and incubated at 37°C for 24  h. Subsequently, the cells were treated with various concentrations of the E2 solution for 72  h. Then, 100 µL of MTT solution (0.5 mg/mL) was added to each well. Cells were incubated for 4 h. Finally, 150 µL of DMSO was added to dissolve the formazan crystals. The absorbance was measured at 570  nm by a microplate reader, and the proliferation rate (PR) was calculated. 

Cistanche tubulosa extract

NATURAL CISTANCHE TUBULOSA FOR IMPROVING SEXUAL FUNCTION PHGS75% ECH 30% ACT 12%

Cell proliferation analysis of glycosides of Cistanches on MCF-7 cell lines 

Cell proliferation was measured using the MTT assay for MCF‑7 cells. GCs were dissolved in RPMI‑1640 culture media containing 0.1% DMSO at final concentrations of 0.0175, 0.175, 1.75, 17.5, and 175 µg/ml. MCF‑7 cell lines were cultured in phenol red‑free RPMI‑1640 medium containing 5% CDT‑FBS for 4 days. After washing by PBS three times, 100 µL of FBS‑free RPMI‑1640 medium was added into 96‑well plates at 1.5 × 104 per well and incubated at 37°C for 24  h. Subsequently, the cells were treated with various concentrations of the GCs solution for 24, 48, and 72 h, respectively. Then, 100 µL of MTT solution (0.5 mg/mL) was added to each well. Cells were incubated for 4 h. Finally, 150 µL of DMSO was added to dissolve the formazan crystals. The absorbance was measured at 570  nm by a microplate reader, and the PR was calculated. Phenol red‑free RPMI‑1640 and medium containing E2 (2.725  ×  10−3 µg/ml) were the negative and positive groups, respectively. 

Cell proliferation analysis of glycosides of Cistanches with fulvestrant on MCF-7 cell lines 

Cell proliferation was measured using the MTT assay for MCF‑7 cells. GCs were dissolved in RPMI‑1640 culture media containing 0.1% DMSO at final concentrations of 1.75, 17.5, and 175 µg/ml. MCF‑7 cell lines were cultured in phenol red‑free RPMI‑1640 medium containing 5% CDT‑FBS for 4 days. After washing by PBS three times, 100 µL of FBS‑free RPMI‑1640 medium was added into 96‑well plates at 1.5 × 104 per well and incubated at 37°C for 24  h. Subsequently, the cells were treated with various concentrations of the GCs solution and incubated with fulvestrant  (6.06  ×  10−5 µg/ml) for 48  h. Then, 100 µL of MTT solution  (0.5  mg/mL) was added to each well. Cells were incubated for 4 h. Finally, 150 µL of DMSO was added to dissolve the formazan crystals. The absorbance was measured at 570 nm by a microplate reader, and the PR was calculated. Phenol red‑free RPMI‑1640 and medium containing E2  (2.725 × 10−3 µg/ml) were the negative and positive groups, respectively. 

Cell cycle assay 

GCs were dissolved in RPMI‑1640 culture media containing 0.1% DMSO at final concentrations of 1.75, 17.5, and 175 µg/ml. MCF‑7‑cell lines were cultured in phenol red‑free RPMI‑1640 medium containing 5% CDT‑FBS for 4 days. After washing by PBS three times, 1 mL of FBS‑free RPMI‑1640 medium was added into 6‑well plates at 2.5 × 105 per well and incubated at 37°C for 24  h. Subsequently, the cells were treated with various concentrations of the GCs solution and incubated with fulvestrant  (6.06  ×  10−5 µg/ml) for 48  h. Subsequently, the cells were collected and washed with PBS three times, centrifuged at 4°C, 1000 rpm for 10 min, and fixed with 70% ethanol at −20°C, overnight. After washing with PBS twice, the cells were stained with PI solution (50 mg/mL) containing 1 mg/mL of RNase A and 0.1% Triton X‑100 for 30 min in the dark at 4°C. The cell cycle was detected using flow cytometry, and the proliferation index (PI) was calculated as follows. Phenol red‑free RPMI‑1640 and medium containing E2 (2.725  ×  10−3 µg/ml) were the negative and positive groups, respectively. 

PI = (S + G2 M)/(G0 /G1  + S + G2 M) × 100% 

RNA isolation and real-time quantitative polymerase chain reaction analysis 

To measure the level of mRNA, an RT‑quantitative PCR  (qPCR) assay was used. Total cellular RNA was extracted with a TRIzol reagent. For qPCR, RNA was reverse transcribed to cDNA from 4 µg of total RNA using an RT kit. RT‑PCR analyses were conducted using the TB Green™ RT‑PCR Kit. All protocols were performed according to the manufacturer's instructions. The primer pair used for amplification of ERα was 5'‑GGGAAGTATGGCTATGGAATCTG‑3'  (forward) and 5'‑TGGCTGGACACATATAGTCGTT‑3'  (reverse); the primer pair used for amplification of ERβ was 5'‑AGTGCCGCTCTTGGAGAGCTG‑3'  (forward) and 5'‑CCTGGGTCGCTGTGACCAGA‑3'  (reverse). The PCR conditions for ERα and ERβ were 94°C for 3  min followed by 37 and 40  cycles, respectively, of 94°C for 30 s, 58°C for 2  min, and 72°C for 2  min. The primer pair used for amplification of GAPDH was 5'‑GGAGCGAGATCCCTCCAAAAT‑3'  (forward) and 5'‑GGCTGTTGTCATACTTCTCATGG‑3'  (reverse). The PCR conditions for GAPDH were 94°C for 3  min followed by 30  cycles of 94°C for 30 s, 58°C for 2 min, and 72°C for 2 min. Every time RT‑qPCR experiment was repeated more than two times. For this, GAPDH was used as internal control. The relative gene expression of ERα/ERβ of transfectants about control cells was calculated: 2−(∆∆Ct). 

Western blotting 

The expression of ERα and ERβ proteins was detected by western blot analysis as the reported method with minor modifications. Briefly, the MCF‑7 cells were grown in 6‑well plates at 2.5 × 105  cells per well and treated with GCs at the final concentration of 1.75, 17.5, and 175 µg/ml for 48 h, respectively. After incubation, the whole‑cell extracts were prepared using RIPA buffer containing 1 mM PMSF. Proteins in the whole‑cell extracts were separated by 12% sodium dodecyl sulfate‑polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membranes. The membrane was blocked with 5%  (w/v) skim milk dissolved in TBST buffer and incubated with primary and secondary antibodies in turn. Bound antibodies were observed. 

Cistanche tubulosa extract

NATURAL CISTANCHE TUBULOSA FOR IMPROVING ESTROGENIC ACTIVITY PHGS75% ECH 30% ACT 12%

Statistical analysis 

The results were expressed as means and standard deviations, and statistical significance was performed using Student's t‑test with  SPSS 21.0 software (IBM Co., Ltd. America). P  <0.05 was considered statistically significant. 

RESULTS 

After 24 h of E2 treatment, the proliferation of MCF‑7 cells was enhanced [Figure 1a]. 10nM of E2 solution could stimulate the growth of the cells obviously  (123.89%). However, with the increase of E2 concentration, the cell proliferation ability weakened. Hence, 10nM was the optimal concentration of E2 in this experiment. GCs group at the concentrations of 1.75, 17.5, and 175 µg/mg could enhance the proliferation of the MCF‑7 cell lines in a time and dosage‑dependent manner and exhibited a significant difference with a negative group  [Figure  1b]. Compared to the negative group, the E2 group exhibited obvious proliferation (120.06%). Combined medication group  (CMG)  (fulvestrant with E2 or GCs) in the CDT‑FBS medium were incubated with MCF‑4 cells. After 72 h of 

image

incubation, CMG could lead to the incline of PR compared with the individual medication group (IMG) (P < 0.01) [Figure 1c]. Flow cytometry analysis showed that GCs could slightly increase the PI value suggesting that GCs could advance G0/G1 phase cells to S and G2/M phase [Figure 2 and Table 1] and promote cell DNA synthesis. The result indicated that the mechanism of GCs on MCF‑7 was similar to that of E2. In CMG  (fulvestrant with GCs), the PI value of cell PI declined to that of IMG slightly (P < 0.05). RT‑PCR analysis indicated that the expressions of ERα and ERβ mRNA were increased compared with the control group  (P  <  0.01) in a dose‑dependent manner after being treated with different concentrations of GCs for 48 h [Figure 3a and b]. Western blot result indicating that after treatment with various concentrations of GCs for 48  h, contents of ERα and ERβ proteins in MCF‑7 increase with the GCs increased in a dosage‑dependent manner [Figure 3c‑e]. 

CONCLUSION 

In this research, the effect of GCs on the proliferation and cell cycle of MCF‑7 was assayed by the method of MTT and flow cytometry, respectively. GCs could increase the proliferation of MCF‑7  cells at the concentration of 1.75, 17.5, and 175 µg/ml after incubation for 72  h. However, the increase tends to slow down when CCs and fulvestrant are used together. GCs could increase the PI value of MCF‑7 cells, decrease the cell of the G1 phase, and increase the cells of the S and G2 phases.

image

image

Fulvestrant is an ER‑specific antagonist, which blocks the nuclear localization of ER by impairing receptor dimerization and energy‑dependent nuclear transport.[17] In this research, a conclusion has confirmed that fulvestrant can weaken the proliferation of GCs on MCF‑7  cells, and it could affect cell cycle transformation. Hence, this study indicated the estrogenic activity of GCs, and also, ER is the 

image

target of GCs. In the RT‑PCR and western blot experiment, mRNA and protein expressions of ERα and ERβ in the MCF‑7 cells increased with the increase of GC concentration. Hence, GCs can play a role in estrogenic activity according to upregulated mRNA and proteins of ERα and ERβ.

Cistanche tubulosa extract

NATURAL CISTANCHE TUBULOSA FOR IMPROVING ESTROGENIC ACTIVITY PHGS75% ECH 30% ACT 12%

drk-green-rounded-corner-button-buy-now-web


You Might Also Like