The Anti-aging Effects Of Ludwigia Octovalvis On Drosophila Melanogaster And SAMP8 Mice Part 1
Jul 13, 2023
Abstract We investigated the anti-aging effects of Ludwigia octovalvis (Jacq.) P. H. Raven (Onagraceae), is an extract that is widely consumed as a healthful drink in several countries. Using the fruit fly, Drosophila melanogaster, as a model organism, we demonstrated that L. octovalvis extract (LOE) significantly extended fly lifespan on a high, but not a low, calorie diet, indicating that LOE may regulate lifespan through a dietary restriction (DR)-related pathway. LOE also attenuated age-related cognitive decline in both flies and in the senescence-accelerated-prone 8 (SAMP8) mouse, without causing any discernable negative trade-offs, including water intake, food intake, fecundity, or spontaneous motor activity. LOE contained high levels of polyphenols and flavonoids, which possess strong DPPH radical scavenging activity and was shown to attenuate paraquat-induced oxidative damage and lethality in flies. Gas chromatography–mass spectrometry (GC-MS) analyses identified 17 known molecules, of which β-sitosterol and squalene were the two most abundant. We further demonstrated that β-sitosterol could extend lifespan, likely through activating AMP-activated protein kinase (AMPK) in the fat body of adult flies. Our data suggest that LOE is a potent anti-aging intervention with the potential for treating age-related disorders.
Glycoside of cistanche can also increase the activity of SOD in heart and liver tissues, and significantly reduce the content of lipofuscin and MDA in each tissue, effectively scavenging various reactive oxygen radicals (OH-, H₂O₂, etc.) and protecting against DNA damage caused by OH-radicals. Cistanche phenylethanoid glycosides have a strong scavenging ability of free radicals, a higher reducing ability than vitamin C, improve the activity of SOD in sperm suspension, reduce the content of MDA, and have a certain protective effect on sperm membrane function. Cistanche polysaccharides can enhance the activity of SOD and GSH-Px in erythrocytes and lung tissues of experimentally senescent mice caused by D-galactose, as well as reduce the content of MDA and collagen in lung and plasma, and increase the content of elastin, have a good scavenging effect on DPPH, prolong the time of hypoxia in senescent mice, improve the activity of SOD in serum, and delay the physiological degeneration of lung in experimentally senescent mice With cellular morphological degeneration, experiments have shown that Cistanche has the good antioxidant ability and has the potential to be a drug to prevent and treat skin aging diseases. At the same time, echinacoside in Cistanche has a significant ability to scavenge DPPH free radicals and can scavenge reactive oxygen species, prevent free radical-induced collagen degradation, and also has a good repair effect on thymine free radical anion damage.

Click on cistanches herba
【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】
Keywords Ludwigia octovalvis. Dietary restriction. Lifespan. AMPK
Introduction
Understanding aging is a major challenge of our time, given demographic trends and the predicted burdens of an elder society. Studies investigating age-related diseases such as neurodegenerative disease, cancers, and cardiovascular disease have already yielded significant insights into human senescence. Dietary restriction (DR), by reduction of calorie intake without malnutrition or alteration in the balance of dietary components, is known to be the most effective intervention for prolonging healthy lifespan across species, from yeast to flies to mammals (Lin et al. 2000; Wood et al. 2004; Bonkowski et al. 2006; Wu et al. 2013). In rodents, DR can significantly increase lifespan in normal mice and short-lived senescence-accelerated-prone 8 (SAMP8) mice (Weindruch and Walford 1982; Choi and Kim 2000; Simons et al. 2013). In flies, a striking lifespan extension can also be observed (Zheng et al. 2005; Soh et al. 2013). Although studies in primates (rhesus monkey) have not yet generated definitive results regarding the effect of DR on mortality, it is clear that DR in monkeys produces beneficial physiological effects similar to those observed in rodents and flies (Colman et al. 2009; Mattison et al. 2012). It has been shown that lifespan extension by DR is likely mediated through several genetic pathways involving nutrient sensing and metabolism, such as insulin/IGF, sirtuins (Sir), SKN-1, target of rapamycin, and AMP-activated protein kinase (AMPK) pathways (Lin et al. 2000; Kaeberlein et al. 2005; Bishop and Guarente 2007; Alcedo and Kenyon 2004; Stenesen et al. 2013). It appears that Sir2/Sirt1 (Lin et al. 2004) and AMPK (Xiao et al. 2011) can be activated by increased AMP/ATP, ADP/ ATP, or NAD/NADH ratios, reflective of a lower cellular energy status. These, in turn, induce a series of downstream signaling events that transform the metabolic state of cells from energy consumption to energy storage and generation.
Given the practical limits for humans in practicing DR in everyday daily life, the development of DR mimetics has emerged as an exciting field for anti-aging research. Dietary supplements containing nutraceutical compounds or plant extracts may be able to provide safe and effective interventions for prolonging healthy life. Fruit extracts from nectarines and apples, as well as herbal extracts from Rhodiola rosea and Curcuma longa, have already been shown to extend the lifespan in fruit flies, through the reduction of oxidative damage (Boyd et al. 2011; Peng et al. 2011; Schriner et al. 2009; Lee et al. 2010; Schriner et al. 2013). The major components identified in these health-promoting plants as likely candidates for the lifespan-extending effects are polyphenols, which have the potential to act as free radical scavengers or redox-active metal chelators (Galleano et al. 2010). Resveratrol, a polyphenolic compound found largely in the skin of red grapes, is the best-known example of this class of molecules and has been shown to extend the lifespan of species as evolutionarily distant as Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, and Nothobranchius furzeri (Howitz et al. 2003; Wood et al. 2004; Valenzano et al. 2006). Although the anti-oxidative properties of resveratrol have been demonstrated, accumulating evidence suggests that this compound may also act as a potent activator for several longevity-associated genes, including Sir2/Sirt1 mentioned above (Hubbard et al. 2013).
Ludwigia octovalvis (Jacq.) P. H. Raven (Onagraceae) has a wide distribution in tropical areas of many countries around the world. Although the complete chemical composition of L. octovalvis has not been fully described, this plant has a long history of use as a herbal medicine for treating various conditions, including edema, nephritis, and hypotension. Large populations in Asia consume L. octovalvis extract (LOE) as a healthful drink daily. Toxicological evaluation in mice has suggested that chronic LOE treatment may provide immunoregulatory, hepatoprotective, and cardiovascular-protective properties, without observable side effects (Kadum Yakob et al. 2012). In addition, LOE has been reported to have anti-bacterial and anti-cancer activities (Chen et al. 1989; Chang et al. 2004). In this study, we investigated the antiaging effects of LOE, using both fruit flies and SAMP8 mice as model organisms. Our findings suggest that LOE can develop as an anti-aging intervention.
Methods
LOE preparation
Whole plants of L. octovalvis were usually collected during the summer season, and dried plants were obtained from the local Agriculture Improvement Station and Taiwan Herbal Biopharma Company Ltd. in Taiwan. Quality control for L. octovalvis was monitored by Taiwan Herbal Biopharma Company Ltd. and a voucher specimen (No. 034) was deposited at the herbarium of Hsiehyu Biotech Company Ltd. For LOE preparation, 100 g of L. octovalvis powder was soaked in 400 ml of 95 % ethanol overnight at 4 °C and then extracted twice at 55 °C for 30 min. The supernatant was centrifuged (at 8,000×g for 5 min) and filtered (TOYO No. 1) to remove debris. LOE was obtained following a decompression process.
Gas chromatography-mass spectrometry (GC-MS)
GC-MS analysis of LOE was performed using an HP- 6890 gas chromatograph and HP-5973 mass-selective detector (MSD, Agilent Technologies), equipped with a capillary gas chromatography column HP-5MS (12.5 m×0.2 mm I.D., 0.33 μm film thickness) (J&W Scientific). Injection volume was 2 μl in splitless mode, and inlet temperature was 290 °C. Helium was used as the carrier gas (flow rate of 0.6 ml/min), and oven temperature was programmed as follows: initial temperature: 35 °C, increased by 5 °C/min to 90 °C, then by 10 °C/min to 200 °C, and finally by 20 °C/min to 290 °C, where it was held for 8 min. Analysis was performed in the EI mode, with ionization voltage fixed at 70 eV. Scan acquisition (m/z 45-550) of MSD was carried out with HP Chemistation software.

2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and total content of polyphenols and flavonoids
DPPH radical scavenging activity was measured using a modified method described previously (Brand-Williams et al. 1995). Briefly, 100 μl of different concentrations of LOE, ascorbic acid, resveratrol, squalene, or β- sitosterol (Sigma) was added to 200 μl of 100 μM DPPH in 96-microwell plates to reach final concentrations of 0, 1, 5, 10, and 50 μg/ml. The reaction mixture was incubated in the dark at room temperature for 30 min. A decrease in absorbance was measured at 520 nm in a microplate reader (AccuReader 965). Total phenolic constituents of LOE were determined with the Folin–Ciocalteu reagent, using gallic acid as a standard (Slinkard and Singleton 1977). Entire flavonoid contents were measured with an aluminum chloride colorimetric assay, with rutin used as a standard (Shih et al. 2010).
Cell culture and Western blot analyses
Drosophila Schneider (S2) cells were grown at 25 °C in Schneider's Drosophila medium (Invitrogen), supplemented with 10 % heat-inactivated fetal bovine serum (Gibco). Cells were treated with different concentrations of LOE and β-sitosterol (Sigma) under normal (1× medium, as above) growth conditions or under DR conditions (0.5× medium, 1:1 dilution of the 1× medium in phosphate-buffered saline (PBS)) for 12 h. Protein levels of phosphor-AMPK and α-tubulin (antibodies from Cell Signaling Technology) were analyzed by Western blot as described previously (Wang et al. 2005).
Flies and lifespan assays
Canton-S (CS), w1118, fat body GeneSwitch driver S106 (Bloomington Stock Center #8151), and UASAMPK.RNAi (Bloomington Stock Center #32371) stocks were raised on standard sucrose/yeast/cornmeal food. S106 virgins were crossed with UASAMPK.RNAi males in AMPK knockdown experiments. For lifespan assays, flies that had eclosed within 48 h (approximately 100 males and 100 females) were transferred to a 1-l population cage and maintained in a humidified, temperature-controlled incubator with 12-h on/off light cycle at 25 °C (Wang et al. 2009). Fresh food was provided every other day, and the number and gender of dead flies were scored. High-calorie and low-calorie foods contained 15 or 5 % of both dextrose and yeast, respectively. Two percent agar and 0.23 % Tegosept (Apex) were added to all foods. Different concentrations of LOE, squalene, β-sitosterol, RU486 (Mifepristone, Sigma), or vehicle control were added to the foods described in each experiment.
Feeding, fecundity, and spontaneous motor activity of flies
Ten-day-old flies maintained on high-calorie food containing different concentrations of LOE were transferred to fresh vials of the same food, with the addition of 0.5 % FD&C no. 1 blue food dye. After 24 h, 10 flies were homogenized in a single tube containing PBS, and the amount of ingested dye was determined by spectrophotometer for dye absorbance at 625 nm. Female fecundity was determined by daily counting of eggs produced by three mating pairs. Flies were passed daily to new vials containing appropriate food, and the number of eggs laid was counted and recorded for the first 20 days of adult life. For monitoring activity levels, glass vials containing a single male fly on the appropriate food source were placed in locomotor recording chambers that have circular rings of infrared light sources; beam breaks are recorded as activity (TriKinetics). The data were recorded every 20 s over a 72-h period. Activity monitors were housed in the incubator described above.
Pavlovian olfactory associative short-term memory of flies
Flies at different ages were trained by exposure to electroshock (70 V) that was paired with one odor for 60 s. Subsequently, flies were exposed to a second odor without electroshock for 60 s. Flies were allowed to rest for 45 s and then were subjected to a T-maze test for 2 min, in which they were required to choose between the two odors. The odors used were methyl cyclohexanol (1:1,000 dilution in mineral oil) and or octanol (1.5:1,000 dilution in mineral oil). For all experiments, at least five sessions were performed for each of the odor–electroshock pairing. All data were averaged, and they are shown as a percentage of the memory index for each group. The performance index was calculated by subtracting the number of flies entering the arm in which the odor was paired with the electroshock from the number entering the opposite arm, where the odor was not paired with the electroshock, and dividing by the total number of flies.
Paraquat-induced oxidative stress and 4-hydroxy-2-nominal (HNE) determination
Ten-day-old flies maintained on high-calorie food containing different concentrations of LOE were transferred to vials with filter paper soaked in a solution of 0 or 20 mM paraquat and 6 % dextrose. The number of dead flies was counted every 3 to 4 h. At 12 h, some of the paraquat-treated flies were collected, and HNE was measured by the OxiSelect™ HNE Adduct ELISA Kit (Cell Biolabs), following the protocol provided by the manufacturer.
Animals
All experimental protocols followed the local animal ethics regulations. SAMP8 mice were bred and maintained in the Modular Animal Caging System® (Alternative Design), and their food was sterilized by gamma irradiation. The room had a 12-h on/off light cycle, with the dark phase beginning at 8 p.m. For mice, LOE was added to the drinking water at final concentrations of 0, 50, and 100 μg/ml. Food intake, water consumption, and change in body weight were monitored regularly.

RNA preparation, cDNA synthesis, and quantitative polymerase chain reaction (qPCR)
Total RNA was prepared from at least 30 flies using the RNeasy Mini Kit (Qiagen). The RNA was treated with DNase and converted to cDNA using oligo-d(T)15 (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) as described previously (Chou et al. 2013). qPCR reactions were performed using a StepOnePlus Real-Time PCR Systems (Applied Biosystems), SYBR Green Master Mix (Applied Biosystems), and gene-specific primers were CAAG AGCTATCTGCTCGACTTCAA and CACATTTCGA AAAACTCCATGGT for AMPK-α, and GACGAAAT CAAGGCTAAGGTCG and AATGGGTGTCGCTG AAGAAGTC for GAPDH. A two-step PCR reaction was carried out with denaturation at 95 °C for 15 s, annealing, and extension combined at 60 °C for 1 min in a total of 40 cycles. The mRNA expression level of each target gene compared to GAPDH was quantified by subtraction: Cttarget − CtGAPDH = ΔCt. A difference of one PCR cycle equates to a twofold change in mRNA expression level. The uniqueness of amplicons was confirmed using dissociation curves.
Novel object recognition, elevated-T maze, and open-field tests
For the novel object recognition test, mice were first habituated to an open box (50 cm×25 cm×50 cm) for 10 min per day for two consecutive days, with no objects present. On the third day, mice were placed in the box for 2 min, and two similar objects were then presented to each mouse. The time spent exploring each object was recorded during the subsequent 5-min period (defined as the training session). The mice were then returned to their home cage. One, two, or three hours later, the same animals were re-tested for 5 min in the box with a familiar and a novel object (defined as the memory test session). The object discrimination index was calculated by subtracting the time spent exploring a familiar object from the time spent exploring a novel object and dividing it by the total time spent exploring both objects.
The elevated-T maze was modified from previous studies (Cruz-Morales et al. 2008; De-Mello and Carobrez 2002; Maia et al. 2010; Santos et al. 2006; Takahashi et al. 2005). It consisted of one arm enclosed by walls 15 cm high, perpendicular to two opposing open arms. The three arms had equal dimensions (30 cm×5 cm), and the whole apparatus was elevated 50 cm above the floor. On the training day, each mouse was placed at the distal end of the enclosed arm, facing the intersection of the arms, and was allowed to explore the enclosed arm. The trial ended when the mouse either entered the open arms (all four paws were in the open arm area) or remained in the enclosed arm for 300 s. The number of trials required to reach the avoidance criterion was used to assess the learning ability of the mice during the training sessions. Twenty-four hours following the training sessions, the mice were reexposed to the enclosed arm, and the time that they remained in the enclosed arm was recorded as an assessment of memory retention.
The open field test was performed in an open box (50 cm×25 cm×50 cm). Each mouse was placed at the center of the open field and was allowed to freely explore the apparatus for 1 h. The direction and travel speed of each mouse were recorded by automated observation (Diagnostic and Research Instruments).
Results
LOE-induced lifespan extension is associated with DR
To test whether LOE has an anti-aging effect in vivo, we first examined the lifespan of CS flies raised on foods containing different concentrations of LOE. Male CS flies on high-calorie food had a mean lifespan of 41.5 days, and the addition of 50, 100, and 1,000 μg/ml of LOE to the fly foods extended the lifespan of male flies by 8.9, 16.1, and 9.6 %, respectively (Fig. 1a and Table 1). Female CS flies on high-calorie food had a mean lifespan of only 32.2 days, short in comparison to their male counterparts. However, LOE induced even larger lifespan extension in female CS flies, where 100 μg/ml of LOE had the largest effect (24.2 % extension; Fig. 1b and Table 1), and 100 μg/ml LOE also extended lifespan in both male and female w1118 flies, suggesting that LOE-extended lifespan is not limited to the CS genetic background (Fig. 1c, d and Table 1).
Since DR is a well-documented intervention for extending lifespan, we wanted to test whether the longevity effects of LOE would be altered by DR. Male and female CS flies raised on low-calorie foods showed 17.8 and 49.4 % increases in mean lifespan, respectively, compared to CS flies reared on high-calorie foods (Fig. 1e, f and Table 1). LOE, however, did not induce lifespan extension above that already seen for control flies on low-calorie food (Fig. 1e, f and Table 1), which suggests a relationship between LOE and DR-induced lifespan extension, implying that these interventions may act, at least in part, through the same pathways.
Chronic LOE treatment does not induce negative tradeoffs
Since the LOE-induced lifespan extension is potentially coupled with the DR pathway, we examined whether LOE might reduce the food intake of flies and result in a DR-like status. We monitored the food intake of flies using a standard system of adding dye to their food (Wang et al. 2009). On average, female CS flies ingested much more food compared to age-matched males, but no difference in food intake was observed between control and LOE-treated flies for either gender (Fig. 2a).

In addition to reduced food intake, interventions that extend lifespan can involve negative tradeoffs, such as decreased fecundity and physical activity (Flatt et al. 2008; Wang et al. 2009; Sohal and Buchan 1981). We found that LOE-treated CS flies did not show any difference in egg production for the first 20 days of adult life (Fig. 2b). Both LOE-treated and control CS flies also showed normal circadian rhythm and spontaneous motor activity (Fig. 2c), as noted previously (Wang et al. 2009).
LOE attenuates age-related memory deficits in fruit flies and SAMP8 mice
The functional decline of neurons is a common hallmark of the aging process. We examined the functional memory of flies, using a Pavlovian olfactory associative short-term memory test. CS flies on high-calorie food showed a gradual cognitive decline in the first 20 days of adult life (Fig. 3a). This memory decline was attenuated by DR, with a statistically significant difference seen by day 20 (Fig. 3a, b). LOE also reduced the age-related memory decline in a dose-dependent manner, with flies on 100 μg/ml LOE attaining a plateau level similar to that seen for DR flies (Fig. 3b).
We further investigated the pro-cognitive effect of LOE in SAMP8 mice, which are known to develop early onset of deficits in learning and memory and have been demonstrated to be a suitable model for studying fundamental mechanisms of Alzheimer's disease (Flood and Morley 1992, 1993; Chan et al. 2006; Takeda 2009). In the novel object recognition tests, 3-month-old SAMP8 mice showed sustained recognition memory up to 3 h after the training session, spending more time on the novel object compared to the familiar object (Fig. 3c, d). This memory retention, however, was not observed in 8-month-old SAMP8 mice (Fig. 3c, d). The addition of LOE (100 μg/ml) to the drinking water for 5 months (starting from 3 months old) significantly enhanced the recognition memory retention of SAMP8 mice, even at 3 h after the training session (Fig. 3d). Water supplementation of 50 μg/ml of LOE had fewer beneficial effects, but was able to improve memory retention for up to 2 h (Fig. 3d).
In the elevated-T maze tests, all groups of mice required similar numbers of training trials to reach the avoidance criterion, suggesting that all mice had similar learning abilities (Fig. 3e). In the 24-h memory retrieval tests, only 8-month-old, but not 3-month-old, SAMP8 mice showed a significant deficit in memory retention (Fig. 3f). This age-related deficit of fear memory in SAMP8 mice could also be rescued by a 5-month LOE supplementation in drinking water (Fig. 3f). The pro-cognitive effects of LOE observed above cannot be ascribed to any change in the general motor activity of the mice, as no difference in travel speed or distance was observed in the open field tests (Fig. 3g and data not shown). SAMP8 mice receiving a 5-month LOE treatment showed no effects on food intake or water consumption and no change in body weight (Fig. 3h–j).

【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】






