Zerumbone, A Tropical Ginger Sesquiterpene Of Zingiber Officinale Roscoe, Attenuates α-MSH-Induced Melanogenesis in B16F10 Cells Part 2
Apr 25, 2023
3. Discussion
Although ZER exhibits a variety of biological functions, including anti-inflammatory, anticancer, and antimicrobial activities, its anti-melanogenic properties have not been reported [12]. In the current study, we demonstrated for the first time that Zingiber officinal (ZO) extract and its active ingredient, ZER, have a strong inhibitory effect on α-melanocytes stimulating hormone (α-MSH)-induced melanogenesis.
According to relevant studies,cistanche is a common herb that is known as "the miracle herb that prolongs life". Its main component is cistanoside, which has various effects such as antioxidant, anti-inflammatory, and immune function promotion. The mechanism between cistanche and skin whitening lies in the antioxidant effect of cistanche glycosides. Melanin in human skin is produced by the oxidation of tyrosine catalyzed by tyrosinase, and the oxidation reaction requires the participation of oxygen, so the oxygen-free radicals in the body become an important factor affecting melanin production. Cistanche contains cistanoside, which is an antioxidant and can reduce the generation of free radicals in the body, thus inhibiting melanin production.

Click On Rou Cong Rong Benefits For Whitening
For more info:
david.deng@wecistanche.com WhatApp:86 13632399501
Abnormally increased melanogenesis caused by ultraviolet (UV) irradiation, inflammatory cytokines, and hormonal signaling, is closely associated with pigmentation disorders, such as chloasma and freckles [4]. Upon UV exposure, keratinocytes secrete α-MSH, which stimulates melanin biogenesis in epidermal melanocytes [1]. In the present study, we demonstrated that methanolic root extract of Zingiber officinal (ZO) and ZER strongly suppresses α-MSH-induced melanin accumulation. Comparison of inhibitory effects of arbutin, which is a well-known anti-melanogenic chemical, and ZER on melanin accumulation showed that ZER at 10 µM concentration exhibits approximately 40% stronger anti-melanogenic effect than arbutin in α-MSH-treated B16F10 mouse melanogenic cells.
Several biochemical studies have shown that the essential oil of Zingiber zerumbet rhizomes contains a large amount of ZER, accounting for approximately 13–70% of the plant ZER content. However, small amounts of ZER are present in Zingiber officinal as well [20]. Interestingly, previous reports have shown that Zingiber zerumbet cultivated in South India contains 76.3 to 84.8% of ZER. However, a silviculture farm in India has shown that 1.81% ZER content was found in the rhizome, 0.16% in the root, and 0.09% in the leaf of Zingiber zerumbet [12]. Therefore, these backgrounds suggest that the differences in ZER content of Zingiber zerumbet may not be correlated with geographic or ecological variations, but instead are because of differences in ZER chemotype [12]. If so, why does ZO have anti-melanogenic activity? A possibility could be suggested that other active components of ZO, which are different from ZER, may suppress melanogenesis. Indeed, a previous report has shown that the essential oil of Zingiber officinal rhizome contains numerous bioactive components, such as α-pinene, valencene, and zingiberene [21]. Moreover, anti-melanogenic effects of α-pinene and valencene have also been observed in B16F10 mouse melanoma cells [22,23]. In addition, the melanogenesis-inhibitory effect of [6]-school, the major school in Zingiber officinal rhizomes, has been observed to be through the acceleration of ERK1/2-mediated MITF degradation [24]. These previous reports support our result that multiple types of active components of ZO as well as ZER have anti-melanogenic activity.

Microphthalmia-associated transcription factor (MITF) is a pivotal factor for melanogenesis by facilitating the transcription of genes, such as tyrosinase, tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2), which are required for melanin biosynthesis and transportation [2,25]. Upon UV irradiation, α-MSH derived from keratinocytes activates MITF and up-regulates the expression of its target genes via protein kinase A (PKA)-cAMP response element binding protein (CREB) signaling axis [25]. In addition, several transcription factors, such as SOX10 and LEF1, activate the transcriptional activity of MITF [26]. SOX10 (sex-determining region Y-box 10) can bind to the MITF promoter between −264 and −266 and increase MITF transcription [27]. LEF1 (lymphoid enhancer-binding factor 1) also transcriptionally cooperates with MITF as a non-DNA-binding activator for promoting MITF gene expression upon Wnt (wingless-type) signaling [28]. Post-translational modification of MITF, such as phosphorylation and acetylation, can regulate its protein stability and activity [26]. Especially, phosphorylation of MITF at Ser73, where degradation-promoting PEST sequence is present, leads to proteasome-dependent MITF degradation in response to UV irradiation [17]. Proteasome-dependent MITF degradation is also caused by the phosphorylation of MITF at Ser409 [18]. Phosphorylation of both Ser73 and Ser409 that promotes MITF degradation is dependent on the activation of the ERK1/2 pathway [17,18]. In the present study, we found that ZER suppresses the expression of MITF and its target genes, such as tyrosinase, TYRP1, and TYRP2 upon α-MSH stimulation, independent of the PKA-CREB signaling pathway (Figure 6). Indeed, our results showed that ZER, but not arbutin and kojic acid, is sufficient to reduce α-MSH-induced tyrosinase mRNA and protein expression levels (Figure 2). These results demonstrate that ZER suppresses melanogenesis via the down-regulation of MITF-mediated transcription of melanogenic genes and their protein expression. Ubiquitin-mediated degradation of MITF is partly regulated by sustained extracellular signal-regulated kinases (ERK1/2) activation [6,7]. Our results showed that Zingiber officinal extract (ZO) and ZER increase ERK1/2 phosphorylation, and decrease melanin accumulation in B16F10 cells. Moreover, the selective inhibitor of mitogen-activated protein kinase (MAPK), U0126, effectively restored melanin content, decreased by ZER, suggesting that ERK1/2 signaling is associated with the anti-melanogenic effect of Zingiber officinal (ZO) extract and zerumbone.

Decreased phosphorylation of ERK1/2 by ZER in hepatocellular carcinoma and U937 macrophage cells has been observed previously [29]. In addition, the ethanol extract of Zingiber zerumbet rhizomes has been shown to suppress ERK1/2 phosphorylation in diabetic retinas [30]. In contrast, in this study, we found that ZER increases the phosphorylation of ERK1/2, but not MEK, in a dose-dependent manner (Figure 3A). Consistent with our result, a previous report has shown that 6-gingerol and 6-school, which are the major active components of ginger, attenuate nerve growth factor (NGF)-induced ERK1/2 phosphorylation in mouse hippocampus [31]. Moreover, other experimental evidence has shown that ZER and 6-shogaol accelerate ERK1/2 phosphorylation in THP-1 monocytes and mouse B16F10 melanoma cells, respectively [24,32]. In addition, in mouse B16BL6 melanoma cells that were treated with isosakuranetin, a 40 -O-methylated flavonoid, a decreased phosphorylation of MITF and increased MITF stability have been observed through the suppression of ERK1/2 that subsequently stimulates melanogenesis [33]. Thus, we strongly suggest that ZER and ZO extract-induced ERK1/2 activation might be the reason for the increased phosphorylation of MITF and its destabilization, which leads to the suppression of melanogenesis. Nevertheless, extensive investigation is necessary to address these controversies about Zingiber extracts and their components phosphorylate ERK1/2 differently in multiple types of cells or tissues. Because MEK is a major upstream kinase [34] that phosphorylates ERK1/2 upon oncogenic growth signaling, ZER was considered to alter the activity of ERK1/2 upstream kinase as well. However, our results show that ZER does not affect MEK phosphorylation. Thus, there are two hypotheses for explaining the molecular mechanism of ZER action. (1) ZER directly interacts and inhibits the kinase activity of MEK via a competitive or allosteric inhibitory mechanism, and (2) There are unknown signaling molecules that directly or indirectly get affected by ZER and act as activators of ERK1/2. Interestingly, previous reports have shown that ZER causes oxidative stress through the depletion of intracellular glutathione (GSH) and induction of intracellular reactive oxygen species (ROS) in colorectal and pancreatic cancer cells, respectively [35,36]. Moreover, it has also been reported that increased intracellular ROS modulates ERK1/2 phosphorylation via suppression of dual-specific phosphatase 3 (DUSP3) by the oxidation of Cys-124 [37]. One possible hypothesis could be that increased oxidative stress and suppressed DUSP3 by ZER might be involved in ERK1/2 phosphorylation. In addition, Chen et al. have proposed that ZER attenuates intracellular nitric oxide (NO) accumulation by suppressing NF-κB and iNOS signaling pathways, which prevents mouse cornea from UVB-induced photokeratitis [38]. Nitric oxide (NO) is a melanogenesis-stimulating factor that is released from melanocytes and keratinocytes upon UV irradiation and proinflammatory cytokines [39,40]. This literature suggests the possibility that ZER attenuates α-MSH-induced melanogenesis by maintaining intracellular NO. Therefore, an extended study to demonstrate the molecular mechanism through which ZER activates the ERK1/2 signaling pathway can provide scientific background for the development of skin-whitening cosmetics.
ZER has multiple biological functions, such as anti-inflammatory [41], anti-microbial [42], antioxidant [43], and anti-allergic [44]. Prolonged exposure to ultraviolet A (UVA) irradiation causes photoaging-related dermatological disorders, such as wrinkles and skin cancer by excessive accumulation of reactive oxygen species (ROS) [2]. A previous report has shown that ZER exerts cytoprotection against UVA-irradiation-induced cellular damage in skin keratinocytes by increasing nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated antioxidants gene expression [1]. Our data suggest that ZER, as an active constituent of ZO extract, can be used to treat dermatological disorders, such as skin cancer, wrinkles, and hyperpigmentation, which are caused by UV irradiation. Although here we have shown the anti-melanogenic effect of ZER and ZO extract in B16F10 mouse and G361 human melanoma cells, their anti-melanogenesis activities must be further evaluated in human primary melanocytes before being considered in skin-whitening cosmetics.
4. Materials and Methods
4.1. Reagents and Antibodies
Antibodies against MITF (#12590), p-AKTS473 (#4060), p-CREB (#9398), p-ERK1/2 (#4370), ERK1/2 (#9102), p-MEK (#9154), MEK (#9122), and ERK1/2 inhibitor U0126 were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-Tyrosinase (sc-7833) and β-tubulin (sc-9104) were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-TYRP2 (DCT, ab74073) was purchased from Abcam (Cambridge, UK). Zerumbone (Z3902), arbutin (A4256), kojic acid (K3125), α-MSH (M4135), and L-DOPA (333786) were purchased from Sigma-Aldrich (St. Louis, MO, USA). A stock solution of α-Melanocyte stimulating hormone was prepared in phosphate-buffered saline (PBS) before treatment. Recombinant human SCF was obtained from R&D systems (Minneapolis, MN, USA) and its stock solution (10 µM) was prepared in PBS. Stock solutions of zerumbone (20 mM), arbutin (1 M), and kojic acid (0.2 M) were prepared in dimethyl sulfoxide (DMSO). Lyophilized Zingiber officinal extract (035-061), isolated by 99% methanol, was obtained from Korea Plant Extract Bank (KPEB) (Daejeon, Korea) and Korea Research Institute of Bioscience and Biotechnology (KRIBB) (Daejeon, Korea). A stock solution of Zingiber officinal extract was prepared in DMSO before treatment.

4.2. Cell Culture and Cell Viability Assay
4.3. Immunoblotting and Immunoprecipitation
Immunoprecipitation was performed to detect whether endogenous MITF is phosphorylated at Ser73. 1 mg of cell lysates were incubated with 1 µg of anti-phospho-MITF antibody (pSer73; Sigma-Aldrich, St. Louis, MO, USA) for 16 h at 4 ◦C, followed by incubation with 20 µL of protein A/G-agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA) for 3 h at 4 ◦C. Precipitated proteins were eluted in SDS sample buffer and then phosphorylated MITF (Ser73) protein was measured by immunoblotting using an anti-p-MITF antibody (pSer73). Immunoblotting was performed, as previously described [4]. Briefly, total protein samples were prepared using lysis buffer, containing 1% NP-40 (Nonidet P-40), 150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 10 mM NaF, and a protease inhibitor cocktail. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate proteins in each sample based on their molecular weight. Separated proteins were then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Burlington, MA, USA). Membranes with transferred proteins were then incubated with primary antibodies (1:1000) and secondary antibodies (1:10,000) at 4 ◦C or room temperature. A Chemiluminescent ECL Prime kit (GE Healthcare, Pittsburgh, PA, USA) was used for visualizing protein expressions.
4.4. Measurement of Intracellular and Extracellular Melanin Content
Intracellular and extracellular melanin content was measured and analyzed, as previously described [3]. Mouse melanogenic B16F10 cells were cultured with phenol-red-free DMEM. Cells were then pre-treated with α-MSH (0.1 mM) for 1 h to promote melanogenic stimulation, and incubated with zerumbone for three days. After incubation, the culture medium was transferred into fresh tubes, and cultured cells were harvested and dissolved in 1 N NaOH containing 10% DMSO at 80 ◦C for 1 h. The melanin content of the culture medium and cell extracts was measured at 475 nm (OD475) using an absorbance reader. Melanin content was then normalized to the cellular protein concentration.
4.5. Quantitative RT-PCR
Quantitative real time-PCR was performed as described previously [4]. Briefly, a high-capacity cDNA reverse transcription kit (Applied Biosystems, Waltham, MA, USA) and total RNA (2 µg) were used for cDNA synthesis. SYBR Green PCR Master MIX (Dynebio, Seongnam, Korea) was used for quantitative PCR. The sequence of the PCR primers 50 and 30 was as follows: TCAAGTTTCCAGAGACGGGT and CATCATCAGCCTGGAATCAA for MITF; ATAGGTGCATTGGCTTCTGG and TCTTCACCATGCTTTTGTGG for tyrosinase; CTCATCAAAGATGGCGTCTG and CTTCCTGAATGGGACCAATG for TYRP1.
4.6. Cellular Tyrosinase Activity Assay
Mouse melanogenic B16F10 cells were incubated with 0.1 mM of α-MSH in the absence or presence of zerumbone, arbutin, kojic acid, and Zingiber officinal (ZO) extract, as indicated. Cultured cells were then washed and lysed using cold PBS containing 1% Triton X-100, and the enzymatic activity of tyrosinase was measured using the previously described methodology [4].
4.7. Statistical Analysis
5. Conclusions
The major findings of this study are that Zingiber officinal (ZO) extract and its active ingredient, zerumbone (ZER), (i) attenuates melanin accumulation upon α-MSH stimulation; and, (ii) decrease expression of the melanogenesis-associated transcription factor, MITF, and its target genes by activating ERK1/2 independent of PKA-CREB signaling pathway (Figure 6). These results, therefore, suggest that Zingiber officinal (ZO) extract contained ZER, as an active ingredient, which would be useful in the development of both dermatological cosmetics and skin-whitening products.

References
1. Miyamura, Y.; Coelho, S.G.; Wolber, R.; Miller, S.A.; Wakamatsu, K.; Zmudzka, B.Z.; Ito, S.; Smuda, C.; Passeron, T.; Choi, W.; et al. Regulation of human skin pigmentation and responses to ultraviolet radiation. Pigment Cell Res. 2007, 20, 2–13. [CrossRef] [PubMed]
2. Riley, P.A. Melanogenesis and melanoma. Pigment Cell Res. 2003, 16, 548–552. [CrossRef] [PubMed]
3. Hachiya, A.; Sriwiriyanont, P.; Kobayashi, T.; Nagasawa, A.; Yoshida, H.; Ohuchi, A.; Kitahara, T.; Visscher, M.O.; Takema, Y.; Tsuboi, R. Stem cell factor-KIT signaling plays a pivotal role in regulating pigmentation in mammalian hair. J. Pathol. 2009, 218, 30–39. [CrossRef] [PubMed]
4. Oh, T.I.; Yun, J.M.; Park, E.J.; Kim, Y.S.; Lee, Y.M.; Lim, J.H. Plumbagin suppresses alpha-msh-induced melanogenesis in b16f10 mouse melanoma cells by inhibiting tyrosinase activity. Int. J. Mol. Sci. 2017, 18, 320. [CrossRef] [PubMed]
5. Busca, R.; Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 2000, 13, 60–69. [CrossRef] [PubMed]
6. Kim, D.S.; Hwang, E.S.; Lee, J.E.; Kim, S.Y.; Kwon, S.B.; Park, K.C. Sphingosine-1-phosphate decreases melanin synthesis via sustained ERK activation and subsequent MITF degradation. J. Cell Sci. 2003, 116, 1699–1706. [CrossRef] [PubMed]
7. Wu, M.; Hemesath, T.J.; Takemoto, C.M.; Horstmann, M.A.; Wells, A.G.; Price, E.R.; Fisher, D.Z.; Fisher, D.E. c-Kit triggers dual phosphorylations, which couple activation and degradation of the essential melanocyte factor Mi. Genes Dev. 2000, 14, 301–312. [CrossRef] [PubMed]
8. Kang, S.J.; Choi, B.R.; Lee, E.K.; Kim, S.H.; Yi, H.Y.; Park, H.R.; Song, C.H.; Lee, Y.J.; Ku, S.K. Inhibitory effect of dried pomegranate concentration powder on melanogenesis in B16F10 melanoma cells; involvement of p38 and PKA signaling pathways. Int. J. Mol. Sci. 2015, 16, 24219–24242. [CrossRef] [PubMed]
9. Bae, J.S.; Han, M.; Yao, C.; Chung, J.H. Chaetocin inhibits IBMX-induced melanogenesis in B16F10 mouse melanoma cells through activation of ERK. Chem. Biol. Interact. 2016, 245, 66–71. [CrossRef] [PubMed]
10. Hakozaki, T.; Miwalla, L.; Zhuang, J.; Chhoa, M.; Matsubara, A.; Miyamoto, K.; Greatens, A.; Hillerbrand, G.G.; Bissett, D.L.; Boissy, R.E. The effect of niacinamide on reducing cutaneous pigmentation and suppression of melanosome transfer. Br. J. Dermatol. 2002, 147, 20–31. [CrossRef] [PubMed]
11. Pillaiyar, T.; Manickam, M.; Jung, S.H. Downregulation of melanogenesis: drug discovery and therapeutic options. Drug Discov. Today 2017, 22, 282–298. [CrossRef] [PubMed]
12. Rahman, H.S.; Rasedee, A.; Yeap, S.K.; Othman, H.H.; Chartrand, M.S.; Namvar, F.; Abdul, A.B.; How, C.W. Biomedical properties of a natural dietary plant metabolite, zerumbone, in cancer therapy and chemoprevention trials. BioMed Res. Int. 2014, 2014, 920742. [CrossRef] [PubMed]
13. Yang, H.L.; Lee, C.L.; Korivi, M.; Liao, J.W.; Rajendran, P.; Wu, J.J.; Hseu, Y.C. Zerumbone protects human skin keratinocytes against UVA-irradiated damages through Nrf2 induction. Biochem. Pharmacol. 2018, 148, 130–146. [CrossRef] [PubMed]
14. Zhang, P.; Liu, W.; Yuan, X.; Li, D.; Gu, W.; Gao, T. Endothelin-1 enhances the melanogenesis via MITF-GPNMB pathway. BMB Rep. 2013, 46, 364–369. [CrossRef] [PubMed]
15. Imokawa, G.; Yada, Y.; Kimura, M. Signaling mechanisms of endothelin-induced mitogenesis and melanogenesis in human melanocytes. Biochem. J. 1996, 314, 305–312. [CrossRef] [PubMed]
16. Kim, H.J.; Yonezawa, T.; Teruya, T.; Woo, J.T.; Cha, B.Y. Nobiletin, a poly ethoxy flflavonoid, reduced endothelin-1 plus SCF-induced pigmentation in human melanocytes. Photochem. Photobiol. 2015, 91, 379–386. [CrossRef] [PubMed]
17. Xu, W.; Gong, L.; Hadda, M.M.; Bischof, O.; Campisi, J.; Yeh, E.H.; Medrano, E.E. Regulation of microphthalmia-associated transcription factor MITF protein levels by association with the ubiquitin-conjugating enzyme hUBC9. Exp. Cell Res. 2000, 255, 135–143. [CrossRef] [PubMed]
18. Wellbrock, C.; Rana, S.; Paterson, H.; Pickersgill, H.; Brummelkamp, T.; Marais, R. Oncogenic BRAF regulates melanoma proliferation through the lineage-specific factor MITF. PLoS ONE 2008, 3, e2734. [CrossRef] [PubMed]
19. Scherle, P.A.; Jones, E.A.; Favata, M.F.; Daulerio, A.J.; Convington, M.B.; Nurnberg, S.A.; Magolda, R.L.; Trzaskos, J.M. Inhibition of MAP kinase prevents cytokine and prostaglandin E2 production in lipopolysaccharide-stimulated monocytes. J. Immunol. 1998, 161, 5681–5686. [PubMed]
20. Sharififi-Rad, M.; Varoni, E.M.; Salehi, B.; Sharififi-Rad, J.; Matthews, K.; Ayatollahi, S.A.; Kobarfard, F.; Ibrahim, S.A.; Mnayer, D.; Zakaria, A.A.; et al. Plants of the genus Zingiber as a source of bioactive phytochemicals: from tradition to pharmacy. Molecules 2017, 22, 2145. [CrossRef] [PubMed]
21. Sharma, P.K.; Singh, V.; Ali, M. Chemical composition and antimicrobial activity of fresh rhizome essential oil of Zingiber Offificinale Roscoe. Pharmacogn. J. 2016, 8, 185–190. [CrossRef]
22. Nam, J.H.; Nam, D.Y.; Lee, D.U. Valencene from the Rhizomes of Cyperus rotundus inhibits skin photoaging-related ion channels and UV-induced melanogenesis in b16f10 melanoma cells. J. Nat. Prod. 2016, 79, 1091–1096. [CrossRef] [PubMed]
23. Chao, W.W.; Su, C.C.; Peng, H.Y.; Chou, S.T. Melaleuca quinquenervia essential oil inhibits α-melanocyte-stimulating hormone-induced melanin production and oxidative stress in B16 melanoma cells. Phytomedicine 2017, 34, 191–201. [CrossRef] [PubMed]
24. Huang, H.C.; Chang, S.J.; Wu, C.Y.; Ke, H.J.; Chang, T.M. [6]-Shogaol inhibits α-MSH-induced melanogenesis through the acceleration of ERK and PI3K/Akt-mediated MITF degradation. BioMed Res. Int. 2014, 2014, 842569. [CrossRef] [PubMed]
25. D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling pathways in melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [CrossRef] [PubMed]
26. Hartman, M.L.; Czyz, M. MITF in melanoma: Mechanisms behind its expression and activity. Cell. Mol. Life Sci. 2015, 72, 1249–1260. [CrossRef] [PubMed]
27. Verastegui, C.; Bille, K.; Ortonne, J.P.; Ballotti, R. Regulation of the microphthalmia-associated transcription factor gene by the Waardenburg syndrome Type 4 gene, SOX10. J. Biol. Chem. 2000, 275, 30757–30760. [CrossRef] [PubMed]
28. Saito, H.; Yasumoto, K.I.; Takeda, K.; Takahashi, K.; Fukuzaki, A.; Orikasa, S.; Shibahara, S. Melanocyte-specific microphthalmia-associated transcription factor isoform activates its gene promoter through physical interaction with Lymphoid-enhancing Factor 1. J. Biol. Chem. 2002, 277, 28787–28794. [CrossRef] [PubMed]
29. Haque, M.A.; Jantan, I.; Harikrishnan, H. Zerumbone suppresses the activation of inflammatory mediators in LPS-stimulated U937 macrophages through MyD88-dependent NF-κB/MAPK/PI3K-Akt signaling pathways. Int. Immunopharmacol. 2018, 55, 312–322. [CrossRef] [PubMed]
30. Hong, T.Y.; Tzeng, T.F.; Liou, S.S.; Liu, I.M. The ethanol extract of Zingiber zerumbet rhizomes mitigates vascular lesions in the diabetic retina. Vasc. Pharmacol. 2016, 76, 18–27. [CrossRef] [PubMed]
31. Lim, S.; Moon, M.; Oh, H.; Kim, H.G.; Kim, S.Y.; Oh, M.S. Ginger improves cognitive function via NGF-induced ERK/CREB activation in the hippocampus of the mouse. J. Nutr. Biochem. 2014, 25, 1058–1065. [CrossRef] [PubMed]
32. Lee, M.H.; Kim, S.H.; Ryu, S.R.; Lee, P.; Moon, C. Enhancing the effects of Zerumbone on THP-1 cell activation. Korean J. Clin. Lab. Sci. 2017, 49, 1–7. [CrossRef]
33. Seger, R.; Krebs, E.G. The MAPK signaling cascade. FASEB J. 1995, 9, 726–735. [CrossRef] [PubMed]
34. Drira, R.; Sakamoto, K. Isosakuranetin, a 40 -O-methylated flflavonoid, stimulates melanogenesis in B16BL6 murine melanoma cells. Life Sci. 2015, 143, 43–49. [CrossRef] [PubMed]
35. Zhang, S.; Liu, Q.; Liu, Y.; Qiao, H.; Liu, Y. Zerumbone, a South Asian ginger sesquiterpene, induced apoptosis of pancreatic carcinoma cells through p53 signaling pathway. Evid. Based Complement. Altern. Med. 2012, 2012, 936030. [CrossRef] [PubMed]
36. Deorukhkar, A.; Ahuja, N.; Mercado, A.L.; Diagaradjane, P.; Raju, U.; Patel, N.; Mohindra, P.; Diep, N.; Guha, S.; Krishnan, S. Zerumbone increases oxidative stress in a thiol-dependent ROS-independent manner to increase DNA damage and sensitize colorectal cancer cells to radiation. Cancer Med. 2015, 4, 278–292. [CrossRef] [PubMed]
37. Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-Mediated Cellular Signaling. Oxid Med Cell Longev. 2016, 4350965. [CrossRef] [PubMed]
38. Chen, B.Y.; Lin, D.P.; Wu, C.Y.; Teng, M.C.; Sun, C.Y.; Tsai, Y.T.; Su, K.C.; Wang, S.R.; Chang, H.H. Dietary zerumbone prevents mouse corena from UVB-induced photokeratitis through inhibition of NF-κB, iNOS, and TNF-α expression and reduction of MDA accumulation. Mol. Vis. 2011, 17, 854–863. [PubMed]
39. Romero-Graillet, C.; Aberdam, E.; Clement, M.; Ortonne, J.P.; Ballotti, R. Nitric oxide produced by ultraviolet-irradiated keratinocytes stimulates melanogenesis. J. Clin. Invest. 1997, 99, 635–642. [CrossRef] [PubMed]
40. Lassalle, M.W.; Igarashi, S.; Sasaki, M.; Wakamatsu, K.; Ito, S.; Horikoshi, T. Effects of melanogenesis-inducing nitric oxide and histamine on the production of eumelanin and pheomelanin in cultured human melanocytes. Pigment Cell Res. 2003, 16, 81–84. [CrossRef] [PubMed]
41. Sulaiman, M.R.; Perimal, E.K.; Akhtar, M.N.; Mohamad, A.S.; Khalid, M.H.; Tasrip, N.A.; Mokhtar, F.; Zakaria, Z.A.; Lajis, N.H.; Israf, D.A. Anti-inflammatory effect of zerumbone on acute and chronic inflflammation models in mice. Fitoterapia 2010, 81, 855–858. [CrossRef] [PubMed]
42. Kader, G.; Nikkon, F.; Rashid, M.A.; Yeasmin, T. Antimicrobial activities of the rhizome extract of Zingiber zerumbet Linn. Asian Pac. J. Trop. Biomed. 2011, 1, 409–412. [CrossRef]
43. Habsah, M.; Amran, M.; Mackeen, M.M.; Lajis, N.H.; Kikuzaki, H.; Nakatani, N.; Rahman, A.A.; Ali, A.M. Screening of Zingiberaceae extracts for antimicrobial and antioxidant activities. J. Ethnopharmacol. 2000, 72, 403–410. [CrossRef]
44. Tewtrakul, S.; Subhadhirasakul, S. Anti-allergic activity of some selected plants in the Zingiberaceae family. J. Ethnopharmacol. 2007, 109, 535–538. [CrossRef] [PubMed]
For more info: david.deng@wecistanche.com WhatApp:86 13632399501






