Golgi Alpha1,2-Mannosidase IA Promotes Efficient Endoplasmic Reticulum-Associated Degradation of NKCC2

Abstract

Mutations in the apically located kidney Na-K-2Cl cotransporter NKCC2 cause type I Bartter syndrome, a life-threatening kidney disorder. We previously showed that transport from the ER represents the limiting phase in NKCC2's journey to the cell surface. Yet very little is known about the ER quality control components specific to NKCC2 and its disease-causing mutants. Here, we report the identification of Golgi alpha1, 2-mannosidase IA (ManIA) as a novel binding partner of the immature form of NKCC2. ManIA interaction with NKCC2 takes place mainly at the cis-Golgi network. ManIA coexpression decreased total NKCC2 protein abundance whereas ManIA knockdown produced the opposite effect. Importantly, ManIA coexpression had a more profound effect on NKCC2 folding mutants. Cycloheximide chase assay showed that in cells overexpressing ManIA, NKCC2 stability, and maturation are heavily hampered. Deleting the cytoplasmic region of ManIA attenuated its interaction with NKCC2 and inhibited its effect on the maturation of the cotransporter. ManIA-induced reductions in NKCC2 expression were offset by the proteasome inhibitor MG132. Likewise, kifunensine treatment greatly reduced the ManIA effect, strongly suggesting that mannose trimming is involved in the enhanced ERAD of the cotransporter. Moreover, depriving ManIA of its catalytic domain fully abolished its effect on NKCC2. In summary, our data demonstrate the presence of a ManIA-mediated ERAD pathway in renal cells promoting the retention and degradation of misfolded NKCC2 proteins. They suggest a model whereby Golgi ManIA contributes to the ERAD of NKCC2, by promoting the retention, recycling, and ERAD of misfolded proteins that initially escape protein quality control surveillance within the ER.

Keywords

kidney; NKCC2; protein quality control; ERAD; Golgi; alpha1,2-mannosidase IA; membrane; trafficking; Bartter syndrome; hypertension

Click here to know the Cistanche benefits

Introduction

The sodium balance and its regulation by the kidney, by regulating the extra-cellular volume, is a key determinant of long-term blood pressure (BP) control, as illustrated by rare monogenic syndromes affecting renal salt handling and considerably altering BP [1,2]. Indeed, although several factors contribute to the pathogenesis and maintenance of blood pressure elevation, renal mechanisms are believed to play a primary role, as hypothesized initially by Guyton [1]. The thick ascending limb of the loop of Henle (TAL) of the kidney is responsible for reabsorbing 20–30% of the filtered load of NaCl [3–5]. At the molecular level, TAL Na-Cl reabsorption is mediated by luminal Na-K-2Cl cotransporter NKCC2 [5]. As a consequence, NKCC2 transport function has a considerable impact on final urinary salt excretion, subsequently influencing long-term blood sodium balance [3,5]. Accordingly, inherited variations of the cotransporter and/or its regulators affect BP in humans [3,6–8]. Indeed, the inactivation of NKCC2 causes type I Bartter syndrome (BS1), a life-threatening renal disease featuring low BP along with electrolyte abnormalities [9], whereas the enhanced activity of the cotransporter has been linked to high BP [2,10–13]. Moreover, in several animal models of salt-sensitive hypertension [14,15], NKCC2 protein expression is increased and contributed to the development of hypertension. In addition to its role in BP homeostasis, NKCC2 activity is also essential for the regulation of water balance [5,16]. In support of this notion, NKCC2 inactivation in patients with BS1 and BS5 causes the development of severe polyuria [7,8,17]. Moreover, the impaired urinary-concentrating ability of aging kidneys is attributed, at least in part, to the reduced level of NKCC2 protein [18,19]. It is worth emphasizing that in all animal models of hypertension and aging, NKCC2 appears to be regulated mainly by post-translational mechanisms [5,16,19], underlining therefore the need to study the factors regulating the biogenesis and trafficking of NKCC2. Despite this, our knowledge of the molecular mechanisms underlying intracellular trafficking of wild-type and mutated NKCC2 proteins in mammalian cells, in particular its regulation by protein–protein interaction, remained very poor. Furthermore, the vast majority of previous reports focused mainly on the post-Golgi regulation of the cotransporter, in particular by phosphorylation [20–22], and therefore very little is known today about the regulation of the transporters at the ER and pre-Golgi level.

To operate correctly, NKCC2 must be properly targeted to the apical cell surface and expressed sufficiently to permit TAL cells to adapt appropriately to physiological or pathological challenges [3,23]. Like all transmembrane proteins, the preparation for NKCC2 appropriate trafficking to the cell membrane begins as the cotransporter protein is synthesized in the endoplasmic reticulum (ER) and continues as the protein transits through the Golgi network [24,25]. Likewise, similar to virtually all proteins destined for the plasma membrane, NKCC2 proteins translocated into the endoplasmic reticulum (ER) undergo quality control, such that only folded proteins are moved through the secretory pathway [26,27]. Control of protein folding in the ER is often related to N-glycosylation, a posttranslational modification initiated by the covalent linkage of a specific oligosaccharide (Glc3Man9GlcNAc2) to a nascent protein [28,29]. Once this oligosaccharide is transferred, several successive steps of protein maturation follow along the secretory pathway [28,30]. After the removal of three glucose residues and the beginning of mannose trimming in the ER, as part of the quality control process, correctly folded proteins are transferred to the Golgi apparatus for maturation [26,28]. High mannose N-glycans are then further trimmed by specific mannosidases such as Golgi α1,2-mannosidases in the cis-Golgi [31,32]. The addition of GlcNAc, galactose, sialic acid, and fucose sugars generate hybrid and complex N-glycans within the medial- and trans-Golgi compartments [33,34]. Subsequently, mature N-glycosylated proteins are targeted to their final destination. When the folding process fails, the terminal mannose residues from the core glycan structure are progressively trimmed, and defective proteins are translocated across the membrane for cytosolic proteasome degradation through mechanisms known as ERAD (endoplasmic reticulum-associated degradation [26,35]). The remaining aberrant proteins, which can form aggregates or cannot be detected by ERAD chaperones, are delivered to lysosomes for clearance via pathways collectively referred to as ER-page [36,37]. Nevertheless, some misfolded proteins can still escape the ER and advance to the Golgi, where they are subjected to a Golgi quality control (GQC) and targeted to lysosome or proteasome for degradation [38]. Both wild-type and mutant variants of transmembrane proteins are prone to ER quality control and degradation. The chloride channel protein CFTR (cystic fibrosis transmembrane conductance regulator), characterized as the first integral membrane mammalian ERAD substrate, is the best example [39,40]. Under normal conditions, up to 70% of wild-type CFTR is degraded by ERAD [39,40]. Even more impressively, the deletion of phenylalanine 508 (∆F508) the mutation of CFTR responsible for cystic fibrosis, reduces the folding efficiency, resulting in nearly 99% of mutant CFTR being degraded before it can reach the plasma membrane [39,40]. Similar to CFTR and several other transmembrane proteins such as HERG [41], ROMK [42], and NCC [43], we have previously shown that the majority of newly synthesized NKCC2 proteins were trapped in the ER and destined for degradation, a process that involves mainly the proteasome pathway [44–46]. ERAD begins with the detection of a misfolded protein by molecular chaperones [47]. The type of chaperones engaged in this process depends principally on the position of the folding lesion of the substrate which can occur either in the ER lumen, ER membrane, or cytoplasm [27,47]. Consequently, three different ERAD pathways have been proposed as ERAD-L (ERAD of substrates with misfolded lesions within the ER lumen), ERAD-M (membrane), and ERAD-C (cytoplasm) [27,47,48]. For instance, the ERAD of nascent CFTR involves both cytoplasmic and ER luminal chaperones [49]. Likewise, NCC, another transmembrane protein, engages several cytoplasmic chaperones for its ERAD [43,50]. Similar to the related kidney-specific electroneutral NCC, NKCC2 possesses 12 transmembrane regions, two large cytoplasmic domains, and a large ER-exposed exofacial loop [5]. Since NKCC2 contains domains in the ER and cytoplasm, an interaction of the cotransporter with ER molecular chaperones on either side or both sides of the ER membrane, is conceivable. Moreover, given that the C-terminal domain of NKCC2 is the predominant cytoplasmic region [5], it is likely to be the major site of protein–protein interaction and therefore to play a paramount role in the biogenesis and trafficking of the cotransporter. In agreement with this notion, we previously identified several binding partners of the NKCC2 C-terminus [46,51–53]. Among those, we showed that aldolase B and SCAMP2 bind to NKCC2 C-terminus at the post-Golgi level and regulate the subcellular redistribution of the cotransporter [51,52]. More recently, we provided evidence that STCH, Hsp70, and the protein-lectin OS9 interact with the immature form of NKCC2 mainly at the ER to regulate its ER-associated degradation [46,53]. In this report, we describe a novel protein–protein interaction between the C-terminal tail of NKCC2 and Golgi α1,2-mannosidase IA (Golgi ManIA, also called Man9-mannosidase), a ubiquitous protein that belongs to the family of class I α-1,2 mannosidases which includes the ER α-mannosidase I (MAN1B1) and two other Golgi α1,2-mannosidases, Golgi α-mannosidase IB [MAN1A2], and Golgi α-mannosidase IC [MAN1C1] [31,54–56]. Interestingly, an increasing body of evidence indicated that α-1,2-mannosidases are not only implicated in protein folding and maturation but also play a pivotal role in misfolded protein degradation [57–60]. Here, we show that ManIA interacts with the immature form of NKCC2 mainly at the cis-Golgi network and promotes its degradation by the proteasome pathway, revealing therefore an additional checkpoint in the surveillance and removal of misfolded NKCC2 proteins. Consequently, these findings may open up new avenues in studying the ER and Golgi quality control of NKCC2 proteins to help in the development of new strategies to prevent and/or treat kidney disorders related to aberrant NKCC2 trafficking and expression.

Cistanche supplement

Materials and Methods

1. Yeast Two-Hybrid Assay

Yeast two-hybrid (Y2H) screening was performed as described previously in detail [51], using as bait the proximal region of the NKCC2 C terminus (residues 661–1095). Briefly, AH109 expressing the bait was mated with the Y187 yeast strain transformed with a human kidney cDNA library. For the selection of positive clones encoding putative interacting proteins, mated yeast cells were first grown on low stringency selection plates (−Leu, −Trp, −His) and then on high stringency selection plates (−Leu, −Trp, −His, −Ade). Selected colonies were also tested for β-galactosidase activity, and DNA from the positive clones was isolated from yeast cells using the RPM yeast plasmid isolation kit (BIO 101 Systems). After rescuing the prey plasmids by transformation into DH5 α bacteria (Invitrogen) and isolation using a Qiagen kit, cDNA plasmids were sequenced and assessed using the BLAST program.

2. Plasmid Construction and Site-Directed Mutagenesis

Generation of WT Myc-NKCC2, unglycosylated Myc-NKCC2 ((N442Q/N452Q) and WT EGFP-NKCC2 was previously described [45,46,51]. The mouse ManIA coding sequence was subcloned into the mammalian expression pcDNA3.1/V5 vector (Invitrogen, Paris, France) to generate WT ManIA-V5 construct. The plasmid comprising ManIA lacking its C-terminus tail (ManIA-∆Cter) was generated through amplification from the WT MAnIAV5 expression construct using forward primer 50 CCGGAGCGATGAAGTTCGTGCTGCTGC 30 and reverse primer 50 TTTCTCTTTGCCATCAATTTC 30. The construct containing ManIA devoid from its N-terminus region (ManIA-∆Nter) was generated also from WT MAnIA-V5 plasmid by QuikChange site-directed mutagenesis method (Stratagene, Les Ulis, France) using forward primer 50 GAGGGCAAAGATCAAAGAGTAGATGACCCATGCTTGGAAT 3 0 and reverse primer 50 ATTCCAAGCATGGGTCATCTACTCTTTGATCTTTGCCCTC 30. All mutations and truncations were confirmed by sequencing.

3. Cell Culture

Opossum kidney cells (OKP cells) were maintained in DMEM (Gibco 42430) supplemented with 10% fetal bovine serum (Eurobio, Les Ulis, France), penicillin (100 U/mL), and streptomycin (100 U/mL) at 37 ◦C in a humidified atmosphere containing 5% CO2. Human embryonic kidney (HEK) 293 cells were grown in DMEM media complemented with 10% fetal bovine serum and 1% penicillin/streptomycin. For plasmid DNA transfection, cells were grown to 60–70% confluence before being transiently transfected for 5 h using Lipofectamine plus kit according to the manufacturer’s instructions (Invitrogen, Paris, France). For protein degradation experiments, cells were treated with MG132 (2 µM) or chloroquine (100 µM) 6 h before cell lysis, as previously described [53,61]. Kifunensine (Sigma k1140, Saint-Quentin-Fallavier, France) was used at 25 µM 6 h before cell lysis.

4. Protein Preparation, Immunoblotting and Immunoprecipitation

After transfection, cells were washed with cold PBS before being solubilized in a lysis buffer containing 120 mM Tris/Hepes, pH 7,4; 150 mM NaCl, 5 mM EDTA, 3 mM KCl; 1% (v/v) Triton X-100 and protease inhibitors (Complete Roche 1697498, Meylan, France). Samples were then harvested and centrifuged at 16,000 rpm for 15 min at 4 ◦C. For immunoprecipitation, cells were solubilized with lysis buffer containing 0.4 M NaCl; 1.5 mM MgCl2; 10 mM Hepes, pH 7.9; 5% (v/v) glycerol; 0.5% (v/v) Nonidet P-40) and protease inhibitors (Complete, Roche Diagnostics). Immunoprecipitation was carried out using anti-V5 (Invitrogen) or anti-ManIA (Sigma ) antibody, and affinity purification using protein G-agarose beads (Dynabeads, Invitrogen, Paris, France). After incubation with protein G-agarose beads for 1 h at room temperature, the immunocomplex was washed in PBS (Invitrogen). The protein samples were then boiled in loading buffer, run on a gradient of 7.5% or 10%, or 15% SDS-polyacrylamide gels, and probed with primary antibodies of interest and horseradish peroxidase-conjugated secondary antibody. Proteins were visualized by enhanced chemiluminescence detection (Thermo Fisher Scientific, Les Ulis, France) according to the manufacturer0 s instructions.

5. Immunocytochemistry

Twenty-four–forty-eight h post-transfection, confluent cells were washed with PBS++ (pH 8, 1 mM MgCl2, and 0.1 mM CaCl2). Cells were then fixed with 2% paraformaldehyde in PBS for 20 min at room temperature before being incubated with 50 mM NH4Cl, and permeabilized with 0.1% Triton X-100 for 1 min. To block no specific antibody binding, cells were incubated with DAKO (antibody diluent with background-reducing components) for 30 min. Fixed cells were incubated for 1h at room temperature with the primary antibody of interest. The primary antibodies used in this study are the following: mouse anti-V5 (Invitrogen, Paris, France), mouse anti–Myc (Takara, Clontech, Saint-Germain-en-Laye, France), rat anti-V5 (Abcam, Paris, France), rabbit anti-Calnexin (Abcam), rabbit anti-Giantin (Abcam), rabbit anti-GM130 (Abcam), rabbit anti-ManIA (Abcam), The secondary antibodies used are the following: goat anti-rabbit Alexa Fluor 555 (Invitrogen), goat anti-rabbit Alexa Fluor 488 (Invitrogen), goat anti-rabbit FITC (DakoCytomation, Trappes, France), goat antimouse Texas red (Invitrogen), goat anti-rat Alexa Fluor 555 (Invitrogen), goat anti-rat Alexa Fluor 488 (Invitrogen), Alexa Texas Red conjugated anti-mouse (Jackson ImmunoResearch, Ely, UK), chicken anti-mouse Alexa Fluor 647 (Invitrogen). After incubations with primary and secondary antibodies of interest, cells were then washed with PBS and mounted with Vectashield.

Herba Cistanche

6. Cycloheximide-Chase Assays

To monitor the stability and maturation of NKCC2, cycloheximide was added at a concentration of 100 µM to OKP or HEK cells 14−16 h post-transfection with NKCC2 plasmids. For the chase period, cell lysates were collected at 0, 1, 2, and 4 h after cycloheximide treatment and analyzed by immunoblotting.

7. siRNA Knockdown

ManIA siRNAs were purchased from Dharmacon as ON-TARGET plus SMART pools (L-012174-00-0005). HEK cells were first transfected with control or specific ManIA siRNAs with Lipofectamine RNAiMAX (Invitrogen) using the manufacturer0 s specifications as performed previously [46,53]. One day after siRNA transfection, cells were transfected with NKCC2 plasmids. After 24–48 h, cell lysates were analyzed for each protein using the indicated antibodies.

8. Statistical Analyses

Data are expressed as mean ± SE. Differences between means were evaluated using paired or unpaired t-tests or ANOVA as appropriate. p < 0.05 was considered statistically significant.

Discussion

This study was carried out to gain insight into the molecular mechanisms underlying the regulation of ER-associated degradation during NKCC2 biogenesis. Using yeast two-hybrid analysis and co-immunoprecipitation assays, we identified GolgiMannosidase IA as a new NKCC2 binding partner. The association implicates only the immature and high-mannose glycosylated form of the cotransporter and takes place mainly at the cis-Golgi network. We have found that ManIA knock-down increases NKCC2 protein abundance whereas its overexpression has the opposite effect. ManIA co-expression impaired NKCC2 maturation by promoting its retention, recycling to the ER, and degradation via the proteasome pathway. Importantly, NKCC2 folding mutants are more prone to the ManIA-mediated ERAD pathway. These findings may help to better understand how abnormalities in NKCC2 protein trafficking lead to Bartter’s syndrome which is essential for elucidating the pathophysiology of BS1 and for improving the available treatments.

It is now clearly established that mannose trimming by class I α1,2-mannosidases is involved in the recognition stage for the ERAD of glycoproteins since this process is greatly reduced by their inhibitors 1-deoxymannojirimycin and kifunensine [67,70–73]. Initially, it was thought, based on studies conducted mainly in yeast, that these compounds hamper ERAD by inhibiting ER α1,2-mannosidase I which primarily cleaves the mannose from the middle B branch of Man9 to form Man8, a glycan signal proposed to initiate ERAD [70,74]. However, in mammalian cells, this hypothesis is not necessarily sound given that both kifunensine and 1-deoxymannojirimycin also inhibit Golgi α1,2-mannosidases. Furthermore, there was increasing evidence in mammalian cells demonstrating that further trimming of three to four α1,2-linked mannose residues, to form Man6GlcNAc2 (M6) or Man5GlcNAc2 (M5), contributes also to triggering the degradation of misfolded glycoproteins [32,75–77]. However, it was not clear which α1,2-mannosidases are responsible for this additional trimming. One candidate is ER a 1,2-mannosidase I itself since its overexpression leads to increased mannose trimming and accelerated ERAD [78–80]. Other possible candidates could be ER-degradation enhancing α-mannosidase-like (EDEM) proteins because both EDEM1 and EDEM3 were reported to stimulate mannose trimming and accelerate glycoprotein ERAD when overexpressed in cells [81,82]. Another possible candidate could be Golgi mannosidase IA which trims Man9 to Man6 and Man5 [31,54]. This enzyme and two other Golgi α1,2 mannosidases (IB, and IC) were shown to enhance the degradation and mannose trimming of an ERAD-L substrate, NHK α1-antitrypsin, when overexpressed in cultured cells [57]. In the present study, we showed evidence of a specific interaction of ManIA with NKCC2, a kidney transmembrane protein. Importantly, we demonstrated that ManIA association in vivo engages only the immature form of the cotransporter. Most importantly, we provided evidence that ManIA binding is involved in the retention and ER-associated degradation of NKCC2.

Cistanche capsules

We previously provided evidence that ERAD and export from the ER constitute the significant regulator of NKCC2 maturation and cell surface expression [8,44–46]. Indeed, we demonstrated that the majority of newly synthesized NKCC2 proteins are targeted to ER-associated degradation involving the proteasome and lysosome pathways [8,44–46,53]. Moreover, we showed that STCH and the protein lectin OS9 are engaged in these processes by interacting with the immature form of NKCC2 mainly at the ER [46,53]. Similar to OS9 and STCH, the involvement of ManIA in the ERAD of the cotransporter was first suggested in the current study by co-immunoprecipitation assays revealing that the association of the proteins involves only the immature form of NKCC2. Of note, deleting the cytoplasmic tail of ManIA reduced but not fully inhibited its interaction with NKCC2, opening therefore the possibility for an interaction of the cotransporter with other regions of ManIA protein. Besides, despite the interaction of ManIA only with the core glycosylated and immature form of NKCC2, our immunocytochemistry studies revealed that ManIA does not colocalize with NKCC2 at the ER. With this regard, it is worth noting that ManIA was reported to be either in the Golgi or in the ER [31,83–85]. Another independent study reported that mannosidase IA may also reside in quality control vesicles [58]. Consequently, because the cellular distribution of ManIA may depend on the cell type, we conducted our study in two different renal cell lines, OKP and HEK cells. The localization studies performed in these cells clearly showed that ManIA is expressed in the Golgi-apparatus in both cell lines and revealed that the site of interaction with the cotransporter is the cis-Golgi network. Of note, given that the N-glycan of glycoproteins at the entrance of the Golgi apparatus is still of high mannose type, it is conceivable that NKCC2 interaction with ManIA can occur indeed at the cis-Golgi network. Using siRNA and overexpression approaches, we have shown that ManIA interacts with the immature NKCC2 to promote its ER-associated degradation. Importantly, the ManIA effect on the mature form of NKCC2 was prevented when the cytoplasmic tail of ManIA was deleted. Even more impressive, the ManIA effect on both immature and mature forms of NKCC2 was completely abrogated when the enzyme was deprived of its catalytic domain. Moreover, NKCC2 regulation by ManIA was also prevented in the presence of the proteasome inhibitor MG132, but not with chloroquine, an inhibitor of lysosomal function, indicating that ManIA targets the immature form of the cotransporter to the proteasome-dependent ERAD pathway. To further support the role of ManIA in the ERAD of NKCC2, we tested also the effect of the mannose-trimming inhibitor kifunensine. Interestingly, kifunensine treatment inhibited the ManIA effect on NKCC2 indicating that mannose trimming is an important process in ManIA-mediated ER-associated degradation of NKCC2. However, the ManIA effect was not fully prevented by kifunensine, which implies that, at least in part, ManIA action on the cotransporter is not fully N-glycan dependent. In support of this notion, mutations of NKCC2 glycosylation sites did not fully inhibit the ManIA effect on the cotransporter confirming therefore that, at least under our experimental conditions, part of the ManIA effect can be N-Glycan independent. In support of this notion, Ron et al. provided evidence that under ER stress conditions, enhanced expression of EDEM1, another alpha-mannosidase protein, bypasses the mannose-trimming event and delivers the glycoprotein directly to late ERAD stages [86]. Indeed, they clearly showed that, upon overexpression of EDEM1, the degradation of the glycoprotein H2a was not blocked by kifunensine [86]. This is of particular interest because our experimental setting i.e., heterologous overexpression of secretory and membrane proteins (NKCC2) causes ER stress [87–89] which can explain, at least in part, the persistence of an effect of ManIA, independently of mannose trimming, on the cotransporter under these conditions. It is worth noting that the remaining ManIA effect on unglycosylated NKCC2 protein was fully blocked by MG132 further corroborating therefore the notion that ManIA promotes the ERAD of NKCC2 in a proteasome-dependent pathway.

The accumulation of misfolded and aggregation-prone polypeptides is harmful to cellular health [90–92]. A larger number (more than 70) of human diseases result from defects in the folding of secretory and membrane proteins [91,92]. To prevent protein misfolding and maintain protein homeostasis in the secretory pathway, eukaryotes cells possess multiple quality control (QC) mechanisms [26]. They include ER quality control (ERQC) via the endoplasmic reticulum–associated degradation (ERAD) pathway [36,48] and ER-page [93] Golgi quality control (QCG) [38] and plasma membrane (PM) quality control [94]. Hence, misfolded proteins, in particular transmembrane proteins with complex topologies such as NKCC2, are stringently inspected by successive quality control checkpoints before reaching their final destinations [26,94]. Moreover, QC pathways can cooperate to efficiently counteract the misfolding of a single protein. For instance, although most misfolded transmembrane proteins are degraded by ERAD, some aberrant proteins, in particular under ER stress conditions, can escape ER surveillance to be packaged into COPII vesicles for anterograde trafficking to the Golgi [95–97]. Evidence obtained from several studies supports the notion that the Golgi apparatus serves as a QC checkpoint [26,38] Indeed, misfolded or unassembled proteins that evade ERAD and ER-page, exit the ER and become GQC substrates that are routed to the vacuole/lysosome for degradation [26,38]. With this regard, it is very unlikely that the lysosome/vacuole-targeted GQC pathway is the mechanism underlying ManIA-induced down-regulation of NKCC2, given that the lysosome inhibitor chloroquine did not prevent the ManIA effect on the cotransporter. Another possibility is that some misfolded proteins entering the Golgi can be targeted for proteasomal degradation after delivery back to the ER. More precisely, the GQC captures the escaped substrates most likely in the cis-Golgi, and cycles them back to the ER for ERAD by the proteasome. This is of great interest because we demonstrated that ManIA colocalizes with NKCC2 mainly at the cis-Golgi network. Moreover, in contrast to chloroquine, the proteasome inhibitor MG132 abolished the ManIA effect on NKCC2, strongly suggesting therefore that the proteasome-targeted GQC is very likely to be the main pathway governing NKCC2 regulation by ManIA. Of note, a very recent study in yeast proposed that some misfolded proteins entering the Golgi can be targeted directly for proteasomal degradation without being cycled back to the ER, a mechanism called EGAD [98]. However, although one cannot exclude this additional mechanism, we clearly showed that upon ManIA co-expression, NKCC2 is largely retained at the ER. Hence, our data strongly suggest ManIA promotes the retention, recycling, and proteasome-dependent ERAD of misfolded NKCC2 proteins that initially escape the ER quality control.

Cistanche tubulosa

An exhaustive exploration of the mechanisms underlying the ERAD machinery has furnished several new insights into how ERAD contributes to human health during both normal and diseased states [48,92]. The importance of ER quality control, in general, and the ERAD phenomenon, in particular, has been mentioned in a large number of human pathologies, called conformational diseases [48,92]. In regards to NKCC2, we previously documented that Bartter syndrome type 1 is among diseases linked to the ERAD pathway [61]. Indeed, although distinct cellular pathways may account for NKCC2 loss of function in BS1 disease, our data revealed that ER-associated protein degradation is the most common mechanism underpinning BS1 [61]. Accordingly, the identification of proteins that bind specifically to the immature forms of WT NKCC2 and its folding mutants is important to decipher the molecular mechanisms underlying the regulation of their ERAD. In the present study, we provided evidence that in addition to WT NKCC2, ManIA interacts with the immature form of NKCC2 mutants A508T and Y998X. Moreover, we demonstrated that ManIA co-expression has a more profound effect on NKCC2 folding mutant A508T when compared to WT NKCC2, strongly suggesting that ManIA may have an important role in the ERAD of NKCC2 mutants during BS1. This is of particular interest because we previously reported that A508T and Y998X are retained at the ER [45,61]. Given that our immunolocalization experiments revealed that, independently of the expression system, ManIA is expressed at the cis-Golgi network, the interaction of the enzyme with these two NKCC2 mutants strongly suggests that even though most A508T and Y998X are largely trapped in the ER, there is significant transfer of these two mutants from the ER to the cis-Golgi where they can be captured by ManIA to be delivered back to the ER. With this regard, Hosokawa et al. showed also that, although most transfected NHK proteins are retained in the ER, some of them evaded the ER quality control and reached the cis-Golgi where they are trimmed by Golgi a 1,2-mannosidases to be targeted for ERAD [57]. Furthermore, several recent studies demonstrated that ERManI, which was initially predicted to function in the ER, was also localized to the Golgi complex in mammalian cells, where it contributes to a Golgi-based quality control checkpoint that facilitates the retrieval of captured ERAD substrates back to the ER [59,60,99]. Of note, given that, like NKCC2, ManIA is a transmembrane protein, it may also transiently interact with the cotransporter at the ER allowing therefore the enzyme to participate in generating the signal that targets misfolded NKCC2 proteins for ERAD either as they transit through the ER or on their way to the Golgi.

In summary, we found that Golgi ManIA interacts with the immature form of NKCC2 at the cis-Golgi to promote its ER retention and accelerate its ERAD by the proteasome pathway. To the best of our knowledge, this is the first study describing the significant role of the Golgi quality control mechanism in NKCC2 biogenesis. Moreover, this also is the first report providing evidence that besides luminal proteins, ManIA can be also involved in the ERAD of transmembrane proteins. Our data strongly suggest that ManIA maneuvers within a cis-Golgi-localized quality control checkpoint to serve as a backup system to ERAD surveillance in the ER, providing, therefore, a powerful additional network for adequate removal of unwanted misfolded NKCC2 proteins protecting, therefore, cells from proteotoxicity caused by the formation of protein aggregates, in particular during Bartter syndrome disease. Undeniably, ManIA cannot work in isolation to mediate the ERAD of the cotransporter. Appropriately, one may plausibly postulate that ManIA works in concert, sequentially or simultaneously, with other NKCC2 binding proteins and ERAD components, such as OS9 [46] and STCH [53] to mediate the ER quality control of the cotransporter. With this regard, we propose a model whereby, under ER stress conditions: (1) OS9 is involved in the retention of misfolded NKCC2 proteins at the ER and its ERAD by the proteasome. (2) STCH plays a crucial role in the ERAD of NKCC2 by the proteasome and lysosome pathways. (3) Golgi ManIA contributes to the ERAD of NKCC2 by capturing misfolded NKCC2 proteins that escaped ER quality control and delivering them back to the ER. Further experiments are needed to uncover the precise mechanism behind this model. The thorough characterization and identification of the specific molecular composition of the ER and Golgi quality controls of NKCC2 and its disease-causing mutants may offer a foundation to define new therapeutic strategies targeting cotransporter transport from the ER and Golgi networks to the cell surface.

References

1. Guyton, A.C. Blood pressure control-special role of the kidneys and body fluids. Science 1991, 252, 1813–1816. [CrossRef] [PubMed]

2. Lifton, R.P.; Gharavi, A.G.; Geller, D.S. Molecular mechanisms of human hypertension. Cell 2001, 104, 545–556. [CrossRef]

3. Castrop, H.; Schiessl, I.M. Physiology and pathophysiology of the renal Na-K-2Cl cotransporter (NKCC2). Am. J. Physiol. Ren. Physiol. 2014, 307, F991–F1002. [CrossRef]

4. Greger, R.; Velazquez, H. The cortical thick ascending limb and early distal convoluted tubule in the urinary concentrating mechanism. Kidney Int. 1987, 31, 590–596. [CrossRef] [PubMed]

5. Gamba, G. Molecular physiology and pathophysiology of electroneutral cation-chloride cotransporters. Physiol. Rev. 2005, 85, 423–493. [CrossRef] [PubMed]

6. Ares, G.R.; Caceres, P.S.; Ortiz, P.A. Molecular regulation of NKCC2 in the thick ascending limb. Am. J. Physiol. Ren. Physiol. 2011, 301, F1143–F1159. [CrossRef] [PubMed]

7. Komhoff, M.; Laghmani, K. Pathophysiology of antenatal Bartter’s syndrome. Curr. Opin. Nephrol. Hypertens. 2017, 26, 419–425. [CrossRef] [PubMed]

8. Laghmani, K.; Beck, B.B.; Yang, S.S.; Seaayfan, E.; Wenzel, A.; Reusch, B.; Vitzthum, H.; Priem, D.; Demaretz, S.; Bergmann, K.; et al. Polyhydramnios, Transient Antenatal Bartter’s Syndrome, and MAGED2 Mutations. N. Engl. J. Med. 2016, 374, 1853–1863. [CrossRef]

9. Simon, D.B.; Lifton, R.P. The molecular basis of inherited hypokalemic alkalosis: Bartter’s and Gitelman’s syndromes. Am. J. Physiol. 1996, 271, F961–F966. [CrossRef]

10. Aviv, A.; Hollenberg, N.K.; Weder, A. Urinary potassium excretion and sodium sensitivity in blacks. Hypertension 2004, 43, 707–713. [CrossRef]

11. Hoorn, E.J.; Walsh, S.B.; McCormick, J.A.; Furstenberg, A.; Yang, C.L.; Roeschel, T.; Paliege, A.; Howie, A.J.; Conley, J.; Bachmann, S.; et al. The calcineurin inhibitor tacrolimus activates the renal sodium chloride cotransporter to cause hypertension. Nat. Med. 2011, 17, 1304–1309. [CrossRef] [PubMed]

12. Borschewski, A.; Himmerkus, N.; Boldt, C.; Blankenstein, K.I.; McCormick, J.A.; Lazelle, R.; Willnow, T.E.; Jankowski, V.; Plain, A.; Bleich, M.; et al. Calcineurin and Sorting-Related Receptor with A-Type Repeats Interact to Regulate the Renal Na(+)-K(+)-2Cl(-) Cotransporter. J. Am. Soc. Nephrol. 2016, 27, 107–119. [CrossRef]

13. Trudu, M.; Janas, S.; Lanzani, C.; Debaix, H.; Schaeffer, C.; Ikehata, M.; Citterio, L.; Demaretz, S.; Trevisani, F.; Ristagno, G.; et al. Common noncoding UMOD gene variants induce salt-sensitive hypertension and kidney damage by increasing uromodulin expression. Nat. Med. 2013, 19, 1655–1660. [CrossRef]

14. Alvarez-Guerra, M.; Garay, R.P. Renal Na-K-Cl cotransporter NKCC2 in Dahl salt-sensitive rats. J. Hypertens. 2002, 20, 721–727. [CrossRef]

15. Capasso, G.; Rizzo, M.; Evangelista, C.; Ferrari, P.; Geelen, G.; Lang, F.; Bianchi, G. Altered expression of renal apical plasma membrane Na+ transporters in the early phase of genetic hypertension. Am. J. Physiol. Ren. Physiol. 2005, 288, F1173–F1182. [CrossRef]

16. Fenton, R.A.; Knepper, M.A. Mouse models and the urinary concentrating mechanism in the new millennium. Physiol. Rev. 2007, 87, 1083–1112. [CrossRef] [PubMed]

17. Komhoff, M.; Laghmani, K. MAGED2: A novel form of antenatal Bartter’s syndrome. Curr. Opin. Nephrol. Hypertens. 2018, 27, 323–328. [CrossRef]

18. Sands, J.M. Urinary concentration and dilution in the aging kidney. Semin. Nephrol. 2009, 29, 579–586. [CrossRef]

19. Tian, Y.; Riazi, S.; Khan, O.; Klein, J.D.; Sugimura, Y.; Verbalis, J.G.; Ecelbarger, C.A. Renal ENaC subunit, Na-K-2Cl, and Na-Cl cotransporter abundances in aged, water-restricted F344 x Brown Norway rats. Kidney Int. 2006, 69, 304–312. [CrossRef] [PubMed]

20. Schiessl, I.M.; Castrop, H. Regulation of NKCC2 splicing and phosphorylation. Curr. Opin. Nephrol. Hypertens. 2015, 24, 457–462. [CrossRef] [PubMed]

21. Davies, M.; Fraser, S.A.; Galic, S.; Choy, S.W.; Katerelos, M.; Gleich, K.; Kemp, B.E.; Mount, P.F.; Power, D.A. Novel mechanisms of Na+ retention in obesity: Phosphorylation of NKCC2 and regulation of SPAK/OSR1 by AMPK. Am. J. Physiol. Ren. Physiol. 2014, 307, F96–F106. [CrossRef]

22. Gamba, G. Regulation of NKCC2 activity by SPAK truncated isoforms. Am. J. Physiol. Ren. Physiol. 2014, 306, F49–F50. [CrossRef] [PubMed]

23. Edwards, A.; Castrop, H.; Laghmani, K.; Vallon, V.; Layton, A.T. Effects of NKCC2 isoform regulation on NaCl transport in thick ascending limb and macula densa: A modeling study. Am. J. Physiol. Ren. Physiol. 2014, 307, F137–F146. [CrossRef]

24. Vitale, A.; Denecke, J. The endoplasmic reticulum gateway of the secretory pathway. Plant. Cell 1999, 11, 615–628. [PubMed]

25. Caplan, M.J. Membrane polarity in epithelial cells: Protein sorting and establishment of polarized domains. Am. J. Physiol. 1997, 272, F425–F429. [CrossRef]

26. Sun, Z.; Brodsky, J.L. Protein quality control in the secretory pathway. J. Cell Biol 2019, 218, 3171–3187. [CrossRef] [PubMed]

27. Ruggiano, A.; Foresti, O.; Carvalho, P. Quality control: ER-associated degradation: Protein quality control and beyond. J. Cell Biol. 2014, 204, 869–879. [CrossRef] [PubMed]

28. Ruddock, L.W.; Molinari, M. N-glycan processing in ER quality control. J. Cell Sci. 2006, 119, 4373–4380. [CrossRef]

29. Molinari, M. N-glycan structure dictates extension of protein folding or onset of disposal. Nat. Chem. Biol. 2007, 3, 313–320. [CrossRef]

30. Hebert, D.N.; Garman, S.C.; Molinari, M. The glycan code of the endoplasmic reticulum: Asparagine-linked carbohydrates as protein maturation and quality-control tags. Trends Cell Biol. 2005, 15, 364–370. [CrossRef]

31. Igdoura, S.A.; Herscovics, A.; Lal, A.; Moremen, K.W.; Morales, C.R.; Hermo, L. Alpha-mannosidases involved in N-glycan processing show cell specificity and distinct subcompartmentalization within the Golgi apparatus of cells in the testis and epididymis. Eur. J. Cell Biol. 1999, 78, 441–452. [CrossRef]

32. Lederkremer, G.Z.; Glickman, M.H. A window of opportunity: Timing protein degradation by trimming of sugars and ubiquitins. Trends Biochem. Sci. 2005, 30, 297–303. [CrossRef] [PubMed]

33. Stanley, P.; Taniguchi, N.; Aebi, M. N-Glycans. In Essentials of Glycobiology, 3rd.; Varki, A., Cummings, R.D., Esko, J.D., Stanley, P., Hart, G.W., Aebi, M., Darvill, A.G., et al., Eds.; Cold Spring Harbor: New York, NY, USA, 2015; pp. 99–111.

34. Barlowe, C.K.; Miller, E.A. Secretory protein biogenesis and traffic in the early secretory pathway. Genetics 2013, 193, 383–410. [CrossRef]

35. Wu, X.; Rapoport, T.A. Mechanistic insights into ER-associated protein degradation. Curr. Opin. Cell Biol. 2018, 53, 22–28. [CrossRef]

36. Sun, Z.; Brodsky, J.L. The degradation pathway of a model misfolded protein is determined by aggregation propensity. Mol. Biol Cell. 2018, 29, 1422–1434. [CrossRef]

37. Fresno, I.; Molinari, M. Proteasomal and lysosomal clearance of faulty secretory proteins: ER-associated degradation (ERAD) and ER-to-lysosome-associated degradation (ERLAD) pathways. Crit. Rev. Biochem. Mol. Biol. 2019, 54, 153–163. [CrossRef] [PubMed]

38. Briant, K.; Johnson, N.; Swanton, E. Transmembrane domain quality control systems operate at the endoplasmic reticulum and Golgi apparatus. PLoS ONE 2017, 12, e0173924. [CrossRef] [PubMed]

39. Jensen, T.J.; Loo, M.A.; Pind, S.; Williams, D.B.; Goldberg, A.L.; Riordan, J.R. Multiple proteolytic systems, including the proteasome, contribute to CFTR processing. Cell 1995, 83, 129–135. [CrossRef]

40. Ward, C.L.; Omura, S.; Kopito, R.R. Degradation of CFTR by the ubiquitin-proteasome pathway. Cell 1995, 83, 121–127. [CrossRef]

41. Gong, Q.; Keeney, D.R.; Molinari, M.; Zhou, Z. Degradation of trafficking-defective long QT syndrome type II mutant channels by the ubiquitin-proteasome pathway. J. Biol. Chem. 2005, 280, 19419–19425. [CrossRef]

42. O’Donnell, B.M.; Mackie, T.D.; Subramanya, A.R.; Brodsky, J.L. Endoplasmic reticulum-associated degradation of the renal potassium channel, ROMK, leads to type II Bartter syndrome. J. Biol. Chem. 2017, 292, 12813–12827. [CrossRef] [PubMed]

43. Needham, P.G.; Mikoluk, K.; Dhakarwal, P.; Khadem, S.; Snyder, A.C.; Subramanya, A.R.; Brodsky, J.L. The thiazide-sensitive NaCl cotransporter is targeted for chaperone-dependent endoplasmic reticulum-associated degradation. J. Biol. Chem. 2011, 286, 43611–43621. [CrossRef] [PubMed]

44. Zaarour, N.; Demaretz, S.; Defontaine, N.; Zhu, Y.; Laghmani, K. Multiple evolutionarily conserved Di-leucine like motifs in the carboxyl terminus control the anterograde trafficking of NKCC2. J. Biol. Chem. 2012, 287, 42642–42653. [CrossRef]

45. Zaarour, N.; Demaretz, S.; Defontaine, N.; Mordasini, D.; Laghmani, K. A highly conserved motif at the COOH terminus dictates endoplasmic reticulum exit and cell surface expression of NKCC2. J. Biol. Chem. 2009, 284, 21752–21764. [CrossRef] [PubMed]

46. Seaayfan, E.; Defontaine, N.; Demaretz, S.; Zaarour, N.; Laghmani, K. OS9 Protein Interacts with Na-K-2Cl Co-transporter (NKCC2) and Targets Its Immature Form for the Endoplasmic Reticulum-associated Degradation Pathway. J. Biol. Chem. 2016, 291, 4487–4502. [CrossRef]

47. Brodsky, J.L. The protective and destructive roles played by molecular chaperones during ERAD (endoplasmic-reticulum-associated degradation). Biochem. J. 2007, 404, 353–363. [CrossRef]

48. Guerriero, C.J.; Brodsky, J.L. The delicate balance between secreted protein folding and endoplasmic reticulum-associated degradation in human physiology. Physiol. Rev. 2012, 92, 537–576. [CrossRef]

49. Ahner, A.; Gong, X.; Frizzell, R.A. Cystic fibrosis transmembrane conductance regulator degradation: Cross-talk between the ubiquitylation and SUMOylation pathways. FEBS J. 2013, 280, 4430–4438. [CrossRef]

50. Donnelly, B.F.; Needham, P.G.; Snyder, A.C.; Roy, A.; Khadem, S.; Brodsky, J.L.; Subramanya, A.R. Hsp70 and Hsp90 multichaperone complexes sequentially regulate thiazide-sensitive cotransporter endoplasmic reticulum-associated degradation and biogenesis. J. Biol. Chem. 2013, 288, 13124–13135. [CrossRef]

51. Benziane, B.; Demaretz, S.; Defontaine, N.; Zaarour, N.; Cheval, L.; Bourgeois, S.; Klein, C.; Froissart, M.; Blanchard, A.; Paillard, M.; et al. NKCC2 surface expression in mammalian cells: Down-regulation by novel interaction with aldolase B. J. Biol. Chem. 2007, 282, 33817–33830. [CrossRef]

52. Zaarour, N.; Defontaine, N.; Demaretz, S.; Azroyan, A.; Cheval, L.; Laghmani, K. Secretory carrier membrane protein 2 regulates exocytic insertion of NKCC2 into the cell membrane. J. Biol. Chem. 2011, 286, 9489–9502. [CrossRef]

53. Bakhos-Douaihy, D.; Seaayfan, E.; Demaretz, S.; Komhoff, M.; Laghmani, K. Differential Effects of STCH and Stress-Inducible Hsp70 on the Stability and Maturation of NKCC2. Int. J. Mol. Sci. 2021, 22, 2207. [CrossRef]

54. Herscovics, A.; Schneikert, J.; Athanassiadis, A.; Moremen, K.W. Isolation of a mouse Golgi mannosidase cDNA, a member of a gene family conserved from yeast to mammals. J. Biol. Chem. 1994, 269, 9864–9871. [CrossRef]

55. Tempel, W.; Karaveg, K.; Liu, Z.J.; Rose, J.; Wang, B.C.; Moremen, K.W. Structure of mouse Golgi alpha-mannosidase IA reveals the molecular basis for substrate specificity among class 1 (family 47 glycosylhydrolases) alpha1,2-mannosidases. J. Biol. Chem. 2004, 279, 29774–29786. [CrossRef]

56. Tulsiani, D.R.; Touster, O. The purification and characterization of mannosidase IA from rat liver Golgi membranes. J. Biol. Chem. 1988, 263, 5408–5417. [CrossRef]

57. Hosokawa, N.; You, Z.; Tremblay, L.O.; Nagata, K.; Herscovics, A. Stimulation of ERAD of misfolded null Hong Kong alpha1- antitrypsin by Golgi alpha1,2-mannosidases. Biochem. Biophys. Res. Commun. 2007, 362, 626–632. [CrossRef] [PubMed]

58. Ogen-Shtern, N.; Avezov, E.; Shenkman, M.; Benyair, R.; Lederkremer, G.Z. Mannosidase IA is in Quality Control Vesicles and Participates in Glycoprotein Targeting to ERAD. J. Mol. Biol. 2016, 428, 3194–3205. [CrossRef]

59. Iannotti, M.J.; Figard, L.; Sokac, A.M.; Sifers, R.N. A Golgi-localized mannosidase (MAN1B1) plays a non-enzymatic gatekeeper role in protein biosynthetic quality control. J. Biol. Chem. 2014, 289, 11844–11858. [CrossRef] [PubMed]

60. Pan, S.; Cheng, X.; Sifers, R.N. Golgi-situated endoplasmic reticulum alpha-1, 2-mannosidase contributes to the retrieval of ERAD substrates through direct interaction with gamma-COP. Mol. Biol. Cell 2013, 24, 1111–1121. [CrossRef] [PubMed]

61. Shaukat, I.; Bakhos-Douaihy, D.; Zhu, Y.; Seaayfan, E.; Demaretz, S.; Frachon, N.; Weber, S.; Komhoff, M.; Vargas-Poussou, R.; Laghmani, K. New insights into the role of endoplasmic reticulum-associated degradation in Bartter Syndrome Type 1. Hum. Mutat. 2021, 42, 947–968. [CrossRef]

62. Fujita, E.; Kouroku, Y.; Isoai, A.; Kumagai, H.; Misutani, A.; Matsuda, C.; Hayashi, Y.K.; Momoi, T. Two endoplasmic reticulum-associated degradation (ERAD) systems for the novel variant of the mutant dysferlin: Ubiquitin/proteasome ERAD(I) and autophagy/lysosome ERAD(II). Hum. Mol. Genet. 2007, 16, 618–629. [CrossRef]

63. Bernasconi, R.; Molinari, M. ERAD and ERAD tuning: Disposal of cargo and of ERAD regulators from the mammalian ER. Curr. Opin. Cell. Biol. 2011, 23, 176–183. [CrossRef]

64. Arvan, P.; Zhao, X.; Ramos-Castaneda, J.; Chang, A. Secretory pathway quality control operating in Golgi, plasmalemma, and endosomal systems. Traffic 2002, 3, 771–780. [CrossRef]

65. Stolz, A.; Wolf, D.H. Endoplasmic reticulum-associated protein degradation: A chaperone assisted journey to hell. Biochim. Biophys. Acta 2010, 1803, 694–705. [CrossRef] [PubMed]

66. Wang, F.; Song, W.; Brancati, G.; Segatori, L. Inhibition of endoplasmic reticulum-associated degradation rescues native folding in loss of function protein misfolding diseases. J. Biol. Chem. 2011, 286, 43454–43464. [CrossRef] [PubMed]

67. Tokunaga, F.; Brostrom, C.; Koide, T.; Arvan, P. Endoplasmic reticulum (ER)-associated degradation of misfolded N-linked glycoproteins is suppressed upon inhibition of ER mannosidase I. J. Biol. Chem. 2000, 275, 40757–40764. [CrossRef] [PubMed]

68. Groisman, B.; Shenkman, M.; Ron, E.; Lederkremer, G.Z. Mannose trimming is required for delivery of a glycoprotein from EDEM1 to XTP3-B and late endoplasmic reticulum-associated degradation steps. J. Biol. Chem. 2011, 286, 1292–1300. [CrossRef] [PubMed]

69. Vargas-Poussou, R.; Feldmann, D.; Vollmer, M.; Konrad, M.; Kelly, L.; van den Heuvel, L.P.; Tebourbi, L.; Brandis, M.; Karolyi, L.; Hebert, S.C.; et al. Novel molecular variants of the Na-K-2Cl cotransporter gene are responsible for antenatal Bartter syndrome. Am. J. Hum. Genet. 1998, 62, 1332–1340. [CrossRef] [PubMed]

70. Helenius, A.; Aebi, M. Roles of N-linked glycans in the endoplasmic reticulum. Annu. Rev. Biochem. 2004, 73, 1019–1049. [CrossRef]

71. Spiro, R.G. Role of N-linked polymannose oligosaccharides in targeting glycoproteins for endoplasmic reticulum-associated degradation. Cell Mol. Life Sci. 2004, 61, 1025–1041. [CrossRef]

72. Marcus, N.Y.; Perlmutter, D.H. Glucosidase and mannosidase inhibitors mediate increased secretion of mutant alpha1 antitrypsin Z. J. Biol. Chem. 2000, 275, 1987–1992. [CrossRef]

73. Liu, Y.; Choudhury, P.; Cabral, C.M.; Sifers, R.N. Intracellular disposal of incompletely folded human alpha1-antitrypsin involves release from calnexin and post-translational trimming of asparagine-linked oligosaccharides. J. Biol. Chem. 1997, 272, 7946–7951. [CrossRef] [PubMed]

74. Cabral, C.M.; Liu, Y.; Sifers, R.N. Dissecting glycoprotein quality control in the secretory pathway. Trends Biochem. Sci. 2001, 26, 619–624. [CrossRef]

75. Ermonval, M.; Kitzmuller, C.; Mir, A.M.; Cacan, R.; Ivessa, N.E. N-glycan structure of a short-lived variant of ribophorin I expressed in the MadIA214 glycosylation-defective cell line reveals the role of a mannosidase that is not ER mannosidase I in the process of glycoprotein degradation. Glycobiology 2001, 11, 565–576. [CrossRef] [PubMed]

76. Foulquier, F.; Duvet, S.; Klein, A.; Mir, A.M.; Chirat, F.; Cacan, R. Endoplasmic reticulum-associated degradation of glycoproteins bearing Man5GlcNAc2 and Man9GlcNAc2 species in the MI8-5 CHO cell line. Eur. J. Biochem. 2004, 271, 398–404. [CrossRef]

77. Avezov, E.; Frenkel, Z.; Ehrlich, M.; Herscovics, A.; Lederkremer, G.Z. Endoplasmic reticulum (ER) mannosidase I am compartmentalized and required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ER-associated degradation. Mol. Biol. Cell 2008, 19, 216–225. [CrossRef]

78. Hosokawa, N.; Tremblay, L.O.; You, Z.; Herscovics, A.; Wada, I.; Nagata, K. Enhancement of endoplasmic reticulum (ER) degradation of misfolded Null Hong Kong alpha1-antitrypsin by human ER mannosidase I. J. Biol. Chem. 2003, 278, 26287–26294. [CrossRef]

79. Sifers, R.N. Cell biology. Protein degradation unlocked. Science 2003, 299, 1330–1331. [CrossRef]

80. Wu, Y.; Swulius, M.T.; Moremen, K.W.; Sifers, R.N. Elucidation of the molecular logic by which misfolded alpha 1-antitrypsin is preferentially selected for degradation. Proc. Natl. Acad. Sci. USA 2003, 100, 8229–8234. [CrossRef] [PubMed]

81. Hirao, K.; Natsuka, Y.; Tamura, T.; Wada, I.; Morito, D.; Natsuka, S.; Romero, P.; Sleno, B.; Tremblay, L.O.; Herscovics, A.; et al. EDEM3, a soluble EDEM homolog, enhances glycoprotein endoplasmic reticulum-associated degradation and mannose trimming. J. Biol. Chem. 2006, 281, 9650–9658. [CrossRef]

82. Olivari, S.; Cali, T.; Salo, K.E.; Paganetti, P.; Ruddock, L.W.; Molinari, M. EDEM1 regulates ER-associated degradation by accelerating de-mannosylation of folding-defective polypeptides and by inhibiting their covalent aggregation. Biochem. Biophys. Res. Commun. 2006, 349, 1278–1284. [CrossRef] [PubMed]

83. Bieberich, E.; Bause, E. Man9-mannosidase from the human kidney is expressed in COS cells as a Golgi-resident type II transmembrane N-glycoprotein. Eur. J. Biochem. 1995, 233, 644–649. [CrossRef] [PubMed]

84. Velasco, A.; Hendricks, L.; Moremen, K.W.; Tulsiani, D.R.; Touster, O.; Farquhar, M.G. Cell type-dependent variations in the subcellular distribution of alpha-mannosidase I and II. J. Cell Biol. 1993, 122, 39–51. [CrossRef] [PubMed]

85. Bieberich, E.; Treml, K.; Volker, C.; Rolfs, A.; Kalz-Fuller, B.; Bause, E. Man9-mannosidase from pig liver is a type-II membrane protein that resides in the endoplasmic reticulum. cDNA cloning and expression of the enzyme in COS 1 cells. Eur. J. Biochem. 1997, 246, 681–689. [CrossRef]

86. Ron, E.; Shenkman, M.; Groisman, B.; Izenshtein, Y.; Leitman, J.; Lederkremer, G.Z. Bypass of glycan-dependent glycoprotein delivery to ERAD by up-regulated EDEM1. Mol. Biol. Cell 2011, 22, 3945–3954. [CrossRef]

87. Casagrande, R.; Stern, P.; Diehn, M.; Shamu, C.; Osario, M.; Zuniga, M.; Brown, P.O.; Ploegh, H. Degradation of proteins from the ER of S. cerevisiae requires an intact unfolded protein response pathway. Mol. Cell 2000, 5, 729–735. [CrossRef]

88. Schroder, M.; Kaufman, R.J. ER stress and the unfolded protein response. Mutat. Res. 2005, 569, 29–63. [CrossRef]

89. Liang, C.J.; Chang, Y.C.; Chang, H.C.; Wang, C.K.; Hung, Y.C.; Lin, Y.E.; Chan, C.C.; Chen, C.H.; Chang, H.Y.; Sang, T.K. Derlin-1 regulates mutant VCP-linked pathogenesis and endoplasmic reticulum stress-induced apoptosis. PLoS Genet. 2014, 10, e1004675. [CrossRef] [PubMed]

90. Houck, S.A.; Singh, S.; Cyr, D.M. Cellular responses to misfolded proteins and protein aggregates. Methods Mol. Biol. 2012, 832, 455–461. [CrossRef] [PubMed]

91. Chaudhuri, T.K.; Paul, S. Protein-misfolding diseases and chaperone-based therapeutic approaches. FEBS J. 2006, 273, 1331–1349. [CrossRef]

92. Yadav, K.; Yadav, A.; Vashistha, P.; Pandey, V.P.; Dwivedi, U.N. Protein Misfolding Diseases and Therapeutic Approaches. Curr. Protein. Pept. Sci. 2019, 20, 1226–1245. [CrossRef]

93. Fresno, I.; Molinari, M. Endoplasmic reticulum turnover: ER-page and other flavors in selective and non-selective ER clearance. F1000Res 2018, 7, 454. [CrossRef]

94. Okiyoneda, T.; Apaja, P.M.; Lukacs, G.L. Protein quality control at the plasma membrane. Curr. Opin. Cell Biol. 2011, 23, 483–491. [CrossRef]

95. Caldwell, S.R.; Hill, K.J.; Cooper, A.A. Degradation of endoplasmic reticulum (ER) quality control substrates requires transport between the ER and Golgi. J. Biol. Chem. 2001, 276, 23296–23303. [CrossRef] [PubMed]

96. Taxis, C.; Vogel, F.; Wolf, D.H. ER-Golgi traffic is a prerequisite for efficient ER degradation. Mol. Biol. Cell 2002, 13, 1806–1818. [CrossRef] [PubMed]

97. Vashist, S.; Ng, D.T. Misfolded proteins are sorted by a sequential checkpoint mechanism of ER quality control. J. Cell Biol. 2004, 165, 41–52. [CrossRef] [PubMed]

98. Schmidt, O.; Weyer, Y.; Baumann, V.; Widerin, M.A.; Eising, S.; Angelova, M.; Schleiffer, A.; Kremser, L.; Lindner, H.; Peter, M.; et al. Endosome and Golgi-associated degradation (EGAD) of membrane proteins regulate sphingolipid metabolism. EMBO J. 2019, 38, e101433. [CrossRef]

99. Pan, S.; Wang, S.; Utama, B.; Huang, L.; Blok, N.; Estes, M.K.; Moremen, K.W.; Sifers, R.N. Golgi localization of ERManI defines the spatial separation of the mammalian glycoprotein quality control system. Mol. Biol. Cell 2011, 22, 2810–2822. [CrossRef]

Sylvie Demaretz 1,2, Elie Seaayfan 1,2,† , Dalal Bakhos-Douaihy 1,2, Nadia Frachon 1,2, Martin Kömhoff 3 and Kamel Laghmani 1,2,

1 Centre de Recherche des Cordeliers, Sorbonne Université, Inserm, Université de Paris, F-75006 Paris, France; sylvie.demaretz@sorbonne-universite.fr (S.D.); elie.seaayfan@uni-marburg.de (E.S.); dalal.bakhos_aldouaihy@sorbonne-universite.fr (D.B.-D.); nadia.frachon@sorbonne-universite.fr (N.F.)

2 CNRS, ERL8228, F-75006 Paris, France

3 Division of Pediatric Nephrology and Transplantation, University Children’s Hospital, Philipps-University, 35043 Marburg, Germany; Martin.Koemhoff@uk-gm.de