Jasminum Sambac Cell Extract As Antioxidant Booster Against Skin Aging Part 1

Jul 03, 2023

Abstract: Oxidative stress plays a major role in the skin aging process through reactive oxygen species production and advanced glycation end products (AGEs) formation. Antioxidant ingredients are therefore needed in the skincare market and the use of molecules coming from plant cell cultures provides a unique opportunity. In this paper, the features of a hydroethanolic extract obtained by Jasminum sambac cells (JasHEx) were explored. The antioxidant and anti-AGE properties were investigated by a multidisciplinary approach combining mass spectrometric and bio-informatic in vitro and ex vivo experiments. JasHEx contains phenolic acid derivatives, lignans, and triterpenes and it was found to reduce cytosolic reactive oxygen species production in keratinocytes exposed to exogenous stress. It also showed the ability to reduce AGE formation and to increase collagen type I production in the extracellular matrix. Data demonstrated that JasHEx antioxidant properties were related to its free radical scavenging and metal chelating activities and the activation of the Nrf2/ARE pathway. This can well explain JasHEx anti-inflammatory activity related to the decrease in NO levels in LPS-stimulated macrophages. Thus, JasHEx can be considered a powerful antioxidant booster against oxidative stress-induced skin aging.

Glycoside of cistanche can also increase the activity of SOD in heart and liver tissues, and significantly reduce the content of lipofuscin and MDA in each tissue, effectively scavenging various reactive oxygen radicals (OH-, H₂O₂, etc.) and protecting against DNA damage caused by OH-radicals. Cistanche phenylethanoid glycosides have a robust scavenging ability of free radicals, a higher reducing ability than vitamin C, improve the activity of SOD in sperm suspension, reduce the content of MDA, and have a certain protective effect on sperm membrane function. Cistanche polysaccharides can enhance the activity of SOD and GSH-Px in erythrocytes and lung tissues of experimentally senescent mice caused by D-galactose, as well as reduce the content of MDA and collagen in lung and plasma, and increase the content of elastin, have a good scavenging effect on DPPH, prolong the time of hypoxia in senescent mice, improve the activity of SOD in serum, and delay the physiological degeneration of lung in experimentally senescent mice With cellular morphological degeneration, experiments have shown that Cistanche has the good antioxidant ability and has the potential to be a drug to prevent and treat skin aging diseases. At the same time, echinacoside in Cistanche has a significant ability to scavenge DPPH free radicals and can scavenge reactive oxygen species, prevent free radical-induced collagen degradation, and also has a good repair effect on thymine free radical anion damage.

cistanche nedir

Click on Where Can I Buy Cistanche

【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】

Keywords: skin aging; reactive oxygen species (ROS); advanced glycation end products (AGEs); Jasminum sambac hydroethanolic extract (JasHEx); mass spectrometry; metabolomics; Global Natural Product Social Molecular Networking (GNPS); nuclear factor erythroid 2-related factor 2 (Nrf2)

1. Introduction

Genetic intrinsic factors and extrinsic agents such as ultraviolet irradiation, infrared irradiation, xenobiotics, and environmental pollutants cause the production of reactive oxygen species (ROS). They are generated by the activation of the mitochondrial respiratory chain, cytochrome p450, and NADPH oxidases [1]. ROS include free radicals (superoxide anion, hydroperoxyl radical, alkoxy radical, and hydroxyl radical) and non-radical molecules (hydrogen peroxide, and singlet oxygen) [2]. When antioxidant systems are overwhelmed, ROS accumulate within cells and generate the so-called oxidative stress that is a main contributor to skin aging [3].

Indeed, oxidative stress causes both DNA damage and lipid and protein oxidation together with the triggering of the mitogen-activated protein kinases (MAPK) pathway (AKT, JNK, ERK, and p38) [4]. This, in turn, promotes the expression of pro-inflammatory cytokines, growth factors, and adhesive molecules through the stimulation of the transcription factors AP-1 and NF-κB. Moreover, MAPK pathway activation causes dermal matrix alterations by reducing collagen levels. It accelerates collagen breakdown by modulating the expression of matrix metalloproteinases (MMPs) and their tissue inhibitors TIMPs and it reduces the synthesis of new collagen, by blocking the TGF-β type II receptor/Smad signaling. In addition to this, oxidative stress alters skin conditions disrupting the epidermal calcium gradient, essential for the integrity and the function of the cornified envelope, stimulating sebaceous glands function and inducing melanocyte degeneration [5].

In parallel, the formation of modified biomolecules known as advanced glycation end products (AGEs) promotes oxidative stress in cells and tissues [6]. The development of these aging biomarkers is induced by various environmental factors such as cigarette smoke, high levels of refined and simple carbohydrate diets, high-temperature cooked foods, and a sedentary lifestyle; AGEs are stable and irreversible products derived from the non-enzymatic reaction between reducing sugars and proteins, nucleic acids or lipids,  followed by further rearrangements [7]. Indeed, the starting point of the AGE formation is the Maillard reaction in which carbonyl groups of reducing sugars react reversibly with free amino groups of proteins, nucleic acids, or aminophospholipid to form Schiff bases. These imines spontaneously rearrange into more stable ketamine, called Amadori products. They produce reactive dicarbonyls (as glyoxal or methylglyoxal) that react with lysine and arginine functional groups of proteins, yielding a great variety of AGEs [8,9]. They are classified into different groups based on their ability to emit fluorescence and form crosslinks.

cistanche nutrilite

AGE action is mediated by the receptors for AGEs (RAGEs) which are transmembrane proteins belonging to the immunoglobulin superfamily of type I cell surface molecules,  expressed in different cell types including keratinocytes, fibroblasts, and macrophages. The binding AGEs/RAGEs increases ROS production mainly by the activation of NADPH  oxidases (NOXes) and the mitochondrial respiratory chain, leading to oxidative stress and all the above-described consequent effects [6,8].

Moreover, extracellular matrix (ECM) proteins, especially collagen, are highly sensitive to glycation. Indeed, the levels of the AGE structure pentosidine, derived from collagen, are significantly higher in old than in young subjects [10]. Collagen glycation changes not only the mechanical properties of the collagen itself, which becomes stiffer and more brittle [11] but also those of the extracellular matrix, affecting the behavior of the resident cells (growth, differentiation, motility, gene expression, and response to cytokines)  and matrix–cell interactions [12].

In this scenario, antioxidant ingredients are in great demand in the cosmetic field to reduce AGE formation and their related oxidative cascade: extracts derived from the specie Jasminum sambac, belonging to the Oleaceae family, are interesting for their antioxidant properties and their joined use in folk medicine to treat skin diseases [13]. However, plant extracts display several disadvantages such as poor bio-sustainability,  the potential contamination with pesticides, fertilizers, or pathogens, and the variability of their qualitative and quantitative composition, affected by seasons and environmental conditions. A valid alternative to plants, as a source of bioactive cosmetic ingredients,  is represented by plant cell cultures that offer several advantages: (i) high sustainability of the production process, since no agricultural land is needed; (ii) continuous supply of natural products without geographical, season and plant reproductive cycle dependence; (iii) no risks of contamination by pathogens, environmental pollutants, and agrochemical residues; (iv) standardized growing conditions that allow obtaining higher and more reproducible rates of biomass and metabolite yield; (v) high versatility, since the concentration of compounds can be optimized by changing culturing conditions and (vi) easier and less time-consuming extraction protocols, reducing the need of aggressive solvents [14,15].

Here, a hydroethanolic extract derived from Jasminum sambac cell cultures (JasHEx)  was studied. The aim of our study is a broad chemical and biological characterization of JasHEx, particularly exploring its anti-glycation and anti-aging properties. First, advanced mass spectrometric-based approaches were used to obtain a detailed structural characterization of the extract. Then, in vitro and ex vivo experiments were performed to prove JasHEx's biological activity as an anti-oxidant.

2. Materials and Methods 

2.1. Plant Tissue Cultures and Extract Preparation

Certified Arabian jasmine (Jasminum sambac) was obtained from a local nursery (“Ladre di Piante”, Pistoia, Toscana Region, Italy). Jasminum sambac leaves were soaked in 70% ethanol (Sigma Aldrich, St. Louis, MO, USA) for 1 min and surface-sterilized with 1% (v/v) of commercial bleach supplemented with Tween 20 (Sigma Aldrich, St. Louis, MO, USA) for 8 min, followed by three rinses in sterile distilled water. Then, the leaves were excised into 0.5–1.0 cm pieces and cultured on full-strength MS medium [16] containing 3% (w/v) sucrose, 0.2 mg/L 2,4D, and 8 g/L phyto-agar. The explants were monthly subcultured onto a fresh medium for three months. Once a yellow-green, friable, and fast-growing callus was obtained, the plant cells were transferred to the liquid MS medium,  supplemented with 3% (w/v) sucrose and 0.2 mg/L 2,4D. The suspension was stirred in a gyratory shaker at 110 pm and 27 ◦C in a dark climate room. The dark-grown cells were scaled up every week from small-scale to large-scale flasks until liquid suspension cultures of about 177 g/L were reached. The preparation of Jasminum sambac cell culture hydro-ethanolic extract (JasHEx) was carried out by the addition of 2000 mL of a solution of ethanol/water (90/10, v/v) to 500 g of cells. The mixture was homogenized for 3 min at 1500 rpm and 6 min at 3800 rpm using a Grindomix GM300 knife mill (Retsch GmbH, Haan, Germany). The obtained suspension was stirred at 400 rpm for 2 h at 25 ◦C, avoiding light exposure. The suspension was then centrifuged at 6300 rpm for 10 min at 4 ◦C. The supernatant was removed, filtered, and then concentrated under a vacuum in a rotary evaporator (IKA RV8, IKA-Werke GmbH & Co., Staufen, Germany) set to 25 ◦C. Finally, the pH was brought to 7.0 with 10 N NaOH and then freeze-dried until gaining a fine powder.

cistanche norge

2.2. UPLC–MS/MS Analysis for JasHEx Chemical Characterization

A biphasic butanol/water extraction was achieved. The butanol fraction was desiccated and thawed in methanol (10 mg/mL) before the UPLC–MS/MS analysis carried out on a Q-Exactive Classic Mass Spectrometer equipped with an UltiMate™ 3000 UPLC  system (Thermo Scientific, Waltham, MA, USA). All the chromatographic runs were carried out as already described by Ceccacci et al. [17].

2.3. Global Natural Products Social Molecular Networking Analyses 

For metabolite identification, Global Natural Products Social Molecular Networking was employed [18]. All those MS and MSMS signals not assigned by GNPS were wisely examined and assigned accordingly to the literature. Raw files were converted to mzXML format by MS Converter General User Interface software,  before GNPS spectral library search. It was carried out using precursor ion mass tolerance of 0.025 Da, fragment ion mass tolerance of 0.02 Da, minimum matched peaks of 2, and score threshold of 0.7. The results were manually confirmed.

Data pre-processing was carried out by Mzmine (Version 2.53, Softpedia, Bucharest, Romania) [19] and a Feature-Based Molecular Networking (FBMN) job [20] was performed as reported by Ceccacci et al. [17]. The obtained network files were imported into Cytoscape (Version 3.9.1, U.S. National Institute of General Medical Sciences (NIGMS), Bethesda, MD, USA) [21].

2.4. Quantitative Analysis of Lignans and Triterpenes

The same UPLC settings stated for the qualitative experiments were employed for the quantitative analysis of lignans, while for that of the triterpenes, they were improved to separate two pairs of isomers, arjunolic/Asiatic acid, and oleanolic/ursolic acid. The analysis was carried out on a Q-Exactive Classic Mass Spectrometer as previously defined. The separation was carried out by a Phenomenex Kinetex (Torrance, CA, USA) EVO C18 300 Å (150 × 2.1 mm, particle size 5 µm). The mobile phase consisted of A (5 mM ammonium acetate aqueous solution, pH 9.00 adjusted by ammonium hydroxide) and B (100% acetonitrile) using a gradient elution of 13–28% B at 0–20 min, 28–65% B at 20–24 min, 65–75% B at 24–28min, 75–95% at 28–28.5 min, 95% at 28.5–32 min, 95–13% at 32–32.1 min and 13% at 32.1–44 min. The flow rate was 0.450 mL/min and the injection volume was 5 µL. For both lignans and triterpenes, data were acquired with the mass method described by Ceccacci et al. [17]. We purchased nortachelogenin (#LCA52174) from Biosynth Carbosynth, matairesinol (#80497) and maslinic acid (#83209) from PhytoLab GmbH & Co.KG, secoisolariciresinol (#60372) and arjunolic acid (#SMB00119) from Sigma-Aldrich (Saint Louis, MI, USA), Asiatic acid (#0027), oleanolic acid (#0041 S) and ursolic acid (#0037 S) from Extrasynthèse (Genay, France). The calibration curves were gained by injecting standards at the concentration of 0.05 to 25 µM for lignans and 0.1 to 25/250 µM for triterpenes. The limit of detection (LOD) and limit of quantification (LOQ) for standards were determined based on the signal-to-noise (S/N) ratio.

2.5. Skin Cell Cultures and Explants 

Immortalized Human Keratinocytes (HaCaT), bought from Addexbio Technologies (San Diego, CA, USA), were preserved in Dulbecco’s Modified Eagle Medium (DMEM; Sigma Aldrich, St. Louis, MO, USA) that was supplemented with 10% fetal bovine serum (FBS; Sigma Aldrich, St. Louis, MO, USA) in 95% air, 5% CO2, and humidified atmosphere at 37 ◦C. Human dermal fibroblasts (HDF) were preserved in Dulbecco’s Modified Eagle Medium (DMEM; Sigma–Aldrich, St. Louis, MO, USA) supplemented with 10% of fetal bovine serum (FBS; Sigma–Aldrich, St. Louis, MO, USA) in 95% air, 5% CO2, and humidified atmosphere at 37 ◦C. Skin explants, obtained from the skin of healthy female donors (aged 31 and 40) at the surgery center Villa Cinzia (Naples, Italy), were cultured in 24-transwell plates in DMEM/FBS plus antibiotics in air–liquid conditions at 37 ◦C in 5% CO2 humidified air. All donors had given their written informed consent for the use of the skin tissues, according to the Declaration of Helsinki.

2.6. Cytosolic ROS Assay in H2O2-Stressed HaCaT Cells

For this process, 1.8 × 104 HaCaT were seeded in 96-well plates and grown for 20 h. The cells were then treated for 2 h with different concentrations of JasHEx (0.0006%, 0.002%, and 0.006% p/v) or with 500 µM ascorbic acid, used as the positive control. After that, they were washed in PBS (Phosphate-buffered saline) and incubated at 37 ◦C with 100 µL/well of a solution containing: 10 mM of Hepes, 1.3 mM CaCl2, 1 mM MgSO4, 5 mM of glucose, and 5 µM CM-H2DCFDA (5-(and-6)-chloromethyl-20,70 -dichlorodihydrofluorescein diacetate, Invitrogen). After 45 min, a PBS wash was performed and the baseline fluorescence intensity of the cells was measured at 535 nm (excitation 485 nm), using the instrument EnVision (PerkinElmer, Waltham, MA, USA). Then, the oxidative stress was induced by adding 450 µM H2O2, and the fluorescence of the samples was measured after 30 min.

2.7. Enzyme-Linked Immunosorbent Assay (ELISA) for AGE Detection in Glyoxal Stressed Human Dermal Fibroblast (HDF) Cells

For this step, 1.5 × 104 HDF were seeded in 96-well plates and grown for 2 days. After washing with PBS, cells were fixed for 10 min with 100 µL of 4% formaldehyde in PBS. Subsequently, they were treated with JasHEx (0.0006% and 0.002% p/v) or the positive control of 1 µM Aminoguanidine in the presence of 0.5% glyoxal at 50 ◦C for 1 week. After incubation, they were processed for an enzyme-linked immunosorbent assay (ELISA) using a specific antibody against AGE (Abcam ab23722).

2.8. ImmunoHistoFluorescence Assay on Methyl-Glyoxal Stressed Skin Explants for Fibrillin-1 Detection

Skin explants were derived from two patients, 31 and 40 years old. From each skin biopsy, three punches were generated for each treatment occurring at the air–liquid interface. On the first day, the punches were treated with JasHEx (0.002% and 0.006% p/v) or the positive control (1 mM Aminoguanidine) and after 24 h, 500 µM methyl-glyoxal was added. The treatments were refreshed every two days for a total of seven days. At the end of the period, the punches were processed for histological analysis, fixed in 4% PFA, incubated in 15% sucrose, then in 30% sucrose, and cryo-stored in OCT compound (Optimal cutting temperature) at −80 ◦C. Cryosection of 5 µm was obtained with the cryostat CM1520 Leica (Leica Biosystems, Buffalo, IL, USA). Slides with cryosections were hydrated for 30 min in PBS and placed in a “blocking” solution (6% BSA, 5% serum, 20 mM MgCl2, 0.2% Tween) for 1 h. Subsequently, they were incubated with the primary anti-Fibrillin 1 antibody (MA5-12770, Thermo Scientific, Waltham, MA, USA). for 16 h at 4 ◦C. The slides were washed with PBS for 30 min and then incubated with the secondary anti-rabbit Alexa-Fluor 546 antibody (A11035, Thermo Scientific, Waltham, MA, USA) for 1 h. The nuclei were stained with DAPI (40, 6-5 diamidino-2-phenylindole) 1 g/mL in PBS for 10 min. The images were acquired with a fluorescence microscope and analyzed with the ImageJ software (Version 1.53a, National Institutes of Health, USA).

2.9. AlphaLISA Assay to Measure Procollagen Type I C-Peptide (PIP) Content

In this step, 8 × 103 HDF were seeded in a 96-well plate and treated for 24 h with JasHEx (0.0006%, 0.002%, and 0.006% p/v) or with TGF-β (2.5 ng/mL). After treatment, the cells were processed according to the instructions of the alpha LISA hPIP collagen kit provider (AL353HV, (PerkinElmer, Waltham, MA, USA)). 

2.10. Nrf2 Luciferase-Based Transcription Activation Assay

Here, 6 × 103 HaCaT cells in a 96-well plate were seeded and grown for 16 h. After that, they were subjected to a Nrf2 luciferase-based transcription activation assay, using the ARE reporter kit BPS Bioscience (San Diego, CA, USA, #60514). A transfection-ready ARE  luciferase reporter vector (containing a firefly luciferase gene under the control of ARE  responsive elements located upstream of a minimal promoter) together with an internal control (a constitutively expressing Renilla luciferase vector) were transiently co-transfected into HaCaT cells using X-TREME gene HP DNA transfection reagent (Roche, Basilea, Switzerland, #6366244001). After transduction for 24 h, cells were treated for 2 h with the extract (0.0006%, 0.002%, and 0.006% p/v) or the positive control Resveratrol (50 µM). After that, they were subjected to the luciferase assay with the Dual-Glo Luciferase Assay System (Promega, Rome, Italy #E2920). Briefly, cells were incubated with firefly luciferase substrate for 10 min before measuring luminescence in a 96-well plate reader (Victor Nivo, Waltham, MA, USA). The ratio of luminescence from firefly and Renilla was calculated to normalize and compare Nrf2 transcriptional activity.

cistanche in urdu

2.11. Analysis of the Expression of SOD-1(NM_000454.5) and OH-1(NM_002133.3) Genes in HaCaT Cells 

For this process, 1.5 × 105 HaCaT cells per well were grown in 6-well plates for 16 h and incubated for 6 h with the extract (0.002% and 0.006% p/v) or 50 µM Resveratrol as the positive control. At the end of incubation, total RNA was extracted using the “GenElute™ Total RNA Purification” kit (from Sigma-Aldrich (Saint Louis, MI, USA)  and treated with DNase I (Thermo Scientific, Waltham, MA, USA) at 37 ◦C for 30 min, to remove genomic DNA contaminant. 500 ng of total RNA was retro-transcribed using the enzyme Reverse transcriptase (Thermo Scientific, Waltham, MA, USA). Semi-quantitative RT-PCRs were conducted using the pair of universal primers 18S primer/competitor (Invitrogen- Thermo Scientific, Waltham, MA, USA) as internal standards. The PCR products were separated on 1.5% agarose gel, and viewed using the iBright instrument (Invitrogen Thermo Scientific, Waltham, MA, USA). The sequences of the primers used for amplification were the following: HsSOD1Fw: GAAAGTAATGGACCAGTGAAGG; HsSOD1Rv: ATTGGGCGATCCCAATTACACC; OH-1Fw GAACTTTCAGAAGGGTCAGG; OH-1Rv GCTCAATGTTGAGCAGGAA.

2.12. Nitric Oxide Assay in LPS-Stimulated RAW 264.7

NO concentration was determined in RAW 264.7 murine macrophages, seeded at a  concentration of 1.5 × 105  cells/well in 96-well plates for 24 h, and pre-treated with the extract (0.0006%, 0.002%, and 0.006% p/v) or with 10 µM TPCK (positive control) for 2 h,  before the incubation with 2 µg/mL LPS for 18 h. The amount of NO, converted into nitrite,  was calculated by adding Griess reagent (solution of N-(1-naphthyl)ethylenediamine and  sulfanilic acid, Invitrogen- Thermo Scientific, Waltham, MA, USA) and, after 30 min, the  absorbance was measured at 540 nm by the multiwell-plate reader (EnVision, PerkinElmer, Waltham, MA, USA)

3. Results 

3.1. Qualitative and Quantitative Analysis of Jasminum sambac Cell Culture Hydro-Ethanolic Extract (JasHEx)

UPLC–MS/MS analysis of JasHEx was performed and high-resolution spectrometric data were analyzed using Global Natural Products Social Molecular Networking (GNPS),  a web-based mass spectrometry system that aids in the annotation of natural products (NPs) [18]. In particular, a GNPS spectral library was performed to achieve online dereplication. Chemical species not identified by GNPS were assigned accordingly to the literature. As shown in Figures 1 and 2 and Table 1, more than 50 compounds belonging to several classes of secondary metabolites, mainly polyphenols and terpenes, were identified. Indeed, JasHEx extract contains phenolic acid derivatives, lignans (secoisolariciresinol, nortrachelogenin, and matairesinol), and triterpenoids (arjunolic acid, aspartic acid, maslinic acid,  oleanolic acid, and ursolic acid).

cistanche tubulosa

cistanche reddit

cistanche supplement


【For more info:george.deng@wecistanche.com / WhatApp:86 13632399501】

You Might Also Like