Part 1 Chemical And Genetic Discrimination Of Cistanches Herba Based On UPLC-QTOF/MS And DNA Barcoding

Contact: Audrey Hu Whatsapp/hp: 0086 13880143964 Email: audrey.hu@wecistanche.com

Abstract

Cistanches Herba (Rou Cong Rong), known as ‘‘Ginseng of the desert’’, has a striking curative effect on strength and nourishment, especially in kidney reinforcement to strengthen yang. However, the two plant origins of Cistanches Herba, Cistanche deserticola and Cistanche tubulosa, vary in terms of the pharmacological action and chemical components. To discriminate the plant origin of Cistanches Herba, a combined method system of chemical and genetic –UPLC-QTOF/MS technology and DNA barcoding–was firstly employed in this study. The results indicated that three potential marker compounds (an isomer of campneoside II, cistanoside C, and cistanoside A) were obtained to discriminate the two origins by PCA and OPLS-DA analyses. DNA barcoding enabled to differentiate two origins accurately. NJ tree showed that two origins clustered into two clades. Our findings demonstrate that the two origins of Cistanches Herba possess different chemical compositions and genetic variations. This is the first reported evaluation of two origins of Cistanches Herba, and the finding will facilitate quality control and its clinical application.

Cistanche Herba

Introduction

Cistanches Herba (Rou Cong Rong), known as ‘‘Ginseng of the desert’’, originates from dried succulent stems of Cistanche deserticola Y.C. Ma and Cistanche tubulosa (Schrenk) Wig according to the Chinese Pharmacopoeia (2010 edition), and is popular for its tonifying the kidney-yin, benefiting life essence and relaxing bowel. Currently, Cistanches Herba is mainly distributed in arid and warm deserts in northwest China, particularly in Xinjiang and Inner Mongolia provinces. However, the two origins of Cistanches Herba differ in terms of their pharmacological activity and chemical components. Tu et al. investigated the decoction of three Cistanche species (C. deserticola, C. tubulosa, Cistanche salsa) and found that C. tubulosa showed the lowest effect in the Yang-deficiency mouse model [1]. Zhang et al. compared pharmacological activity between C. deserticola, C. tubulosa, and C. salsa, and found that these species had medicinal functions such as anti-fatigue and hypoxia tolerance, but not to the same extent [2]. Previous research reported the chemical component and indicated the difference of chemical component and content for plant origins of Cistanches Herba [3]. As for the clinical application and market circulation, as a tonic, C. tubulosa has been traditionally used as a blood circulation-promoting agent and in the treatment of impotence, sterility, lumbago, body weakness in Japan [4–8]. Consequently, it is of great significance to discriminate two origins of Cistanches Herba for quality control and clinical application. However, there is no research focus on discrimination of two origins of Cistanches Herba. Many researched methods, including microscopy, ultraviolet, and infrared detection, inter-simple sequence repeats method have been used to identify the genus of Cistanches, but not only for two origins especially [9–20]. Here, we conjunctively utilized chemical and molecular techniques to distinguish two origins of Cistanches Herba, UPLCQTOF/MS (ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry) and DNA barcoding. UPLC-QTOF/MS provides information more rapidly and efficiently compared with other techniques. The high selectivity and sensitivity of UPLC-QTOF/MS have resulted in its application for both quantitative and qualitative analyses, as well as in metabolite analysis and identification of complex compounds in Traditional Chinese Medicine [21–22]. Principal component analysis (PCA) and orthogonal projection to latent structure discriminant analysis (OPLSDA) are also developed to identify potential marker compounds. DNA barcoding, an easier and more universal molecular marker technology, uses a DNA fragment to identify species or genera. It is objective, more accurate, and easier to perform than traditional identification methods and other molecular marker technologies. Moreover, DNA barcoding has successfully been applied to identify animals and plants, including medicinal plants [23–26]. The purpose of this research is to establish a scientific method system, combined UPLC-QTOF/MS and DNA barcoding, for the discrimination of two plant origins of Cistanches Herba.

Cistanches whole roots

Materials and Methods

Ethics statement We confirm that the field studies did not involve endangered or protected species. GPS coordinates have been included in the sample information, please see table 1."

Plant materials and reagents

Succulent stems of Cistanches Herba were collected from the wild desert regions in Inner Mongolia, Qinghai Provinces, Xinjiang Uygur Autonomous Region, People’s Republic of China (Table 1) in May 2012. The samples of the research were all collected in wild desert regions, not in private land, where no specific permissions were required. The botanical identities of the stems were confirmed by Dr. Linfang Huang. Voucher specimens were deposited at The Institute of Medicinal Plant Development. High-performance liquid chromatography (HPLC)-grade acetonitrile (Merck KGaA, Darmstadt, Germany) and formic acid (Tedia, USA) were utilized for UPLC analysis. Deionized water was purified using a Milli-Q system (Millipore, Bedford, MA, USA). All other chemicals were of analytical grade.

Sample preparation

Cistanches Herba samples (1.0 g, 65-mesh) were transferred into a 50-mL conical flask, and 50 mL of 70% methanol was added. After soaking for 30 min, ultrasonication (35 kHz) was performed at room temperature for 30 min. After centrifugation at 10,000 rev/min for 10 min, the supernatant was stored at 4uC and filtered through a 0.22-mm membrane before injection into the UPLC-QTOF/MS system for analysis.

UPLC-QTOF/MS

For UPLC analysis, the following systems/parameters were used: Waters Acquity system (Waters) equipped with a binary solvent delivery pump, auto-sampler and PDA detector connected to a Waters Empower 2 data station; ultrasonication (250 W, 50 kHz, Kunshan Ultrasonic Instrument Co., Zhejiang, China); and an electronic analytical balance model AB135-2 (MettlerToledo., Greifensee, Zurich, Switzerland). A Waters Acquity UPLC BEH C18 column (1.7 mm, 2.16100 mm, Waters) and a Waters C18 guard column (same material, waters) were used and maintained at 30uC. The mobile phase was 0.1% formic acid aqueous solution (A) and acetonitrile (B) with a gradient program as follows: 0–3 min, 10–22% B; 3–4 min, 22–23% B; 4–6 min, 23–35% B; 6–8 min, 35–37% B; 8–11 min, 37–42% B; 11– 12 min, 42–48% B; 12–15 min, 48%–50% B at a flow rate of 0.3 mL/min. The injection volume was 5 mL.

The UPLC/MS analysis was performed on a QTOF Synapt G2 HDMS system (Waters, Manchester, UK) equipped with an electrospray ionization (ESI) source operated in the negative-ion mode. N2 was used as the desolvation gas. The desolvation temperature was set at 450uC at a flow rate of 800 L/h, and the source temperature was set at 120uC. The capillary and cone voltages were set to 2500 and 40 V, respectively. Data were collected between 50–1200 Da with a 0.1-s scan time and a 0.01-s interscan delay over a 15-min analysis time. Argon was used as the collision gas at a pressure of 7.06661023 Pa. All MS data were collected using the LockSpray system to ensure mass accuracy and reproducibility. The [M-H]- ion of leucine-enkephalin at m/z 554.2615 was used as the lock mass in negative ESI mode.

Data analysis

UPLC-QTOF/MS data for Cistanches Herba samples were analyzed to identify potential discriminant variables. Peak finding, alignment and filtering of ES raw data were carried out using the Marker Lynx applications manager, version 4.1 (Waters, Manchester, UK). The parameters used were as follows: retention time (tR) of 0–15 min, mass of 50–1200 Da, retention time tolerance of 0.02 min, and mass tolerance of 0.02 Da. Three replicate samples collected from each geographic location were used (n = 3). A total of 6, 339 variables were used to create the model.

DNA barcoding: DNA extraction, PCR amplification and sequencing

Samples taken from dried fleshy stems of C. deserticola and C. tubulosa (30 mg) were rubbed for 2 minutes at a frequency of 30 r/ s. DNA was extracted according to the manufacturer’s instructions (Tiangen). Specifically, the protocol was modified such that chloroform was replaced with a mixture of chloroform: isoamyl alcohol (24:1 in the same volume), and buffer solution GP2 with isopropanol (same volume). The rubbed powder was put into 1.5 ml eppendorf tubes, added 700 mL 65uC preheated GP1 and 1 mL b-mercaptoethanol to mix using vortex for 10–20 s, and incubated for 60 minutes at 65uC; Adding 700 mL mixture of chloroform: isoamyl alcohol (24:1), centrifuge for 5 minutes at 12000 rpm(,134006g); Pipette supernatant to a new tube, adding 700 mL isopropanol, blending for 15–20 minutes; Piping all the mixture into spin column CB3 and centrifuge for 40 s at 12000 rpm; Discarding the filtrate and adding 500 mL GD(adding quantitative anhydrous ethanol before use), centrifuge at 12000 rpm for 40 s; discarding the filtrate and adding 700 mL PW(adding quantitative anhydrous ethanol before use) to wash the membrane, centrifuge for 40 s at 12000 rpm; Discarding the filtrate and adding 500 mL PW, centrifuge for 40 s at 12000 rpm; Discarding the filtrate and centrifuge for 2 minutes at 12000 rpm to remove residual wash buffer PW; Transferring the spin column CB3 into a clean 1.5 ml eppendorf tube, and drying at room temperature for 3–5 minutes; Centrifuge for 2 minutes at 12000 rpm to obtain the total DNA. Primers for polymerase chain reaction (PCR) were based on sequences reported previously [4,5]. PCR reaction mixtures contained 2-mL DNA template, 8.5- mL ddH2O, 12.5-mL 26Taq PCR Master Mix (Beijing TransGen Biotech Co., China), 1/1-mL forward/reverse (F/R) primers (2.5 mM), in a final volume of 25 mL. PCR amplification was conducted as described by Kress et al. [4]. The primer of PCR reaction were fwd PA: GTTATGCATGAACGTAATGCTC (59- 39) and rev TH: CGCGCATGGTGGATTCACAATCC (59-39). PCR products were separated and detected by 1% agarose gel electrophoresis. PCR products were purified following the manufacturer’s protocol and directly subjected to sequencing.

The main effective compound of cistanche: Acteoside

Results

Tentative peak assignment by UPLC-QTOF/MS Representative chromatograms of C. deserticola and C. tubulosa from different producing areas are shown in Figure 1. The fingerprint chromatogram indicated similarities among Cistanches Herba samples. A total of 23 qualified mass peaks were detected and 16 peaks were identified by matching the retention times and mass spectra with those reported previously (Table 2) [29–35]. Peaks 2, 3, 5, 6, 7, 8, 9, 11, 12, 15, 16, 17, 20, 21, 22, and 23 were tentatively identified as cistanoside F, mussaenoside acide, cistanbuloside C1/C2, campneoside II, isomer of campneoside II, echinacoside, cistanoside A, acteoside, isoacteoside, syringalide A-39-a-L-rhamnopyranoside, cistanoside C, 29-acetylacteosid, osmanthuside B, cistanoside D, tubuloside B, and cistancinenside A, respectively. Chemical constituents were determined to be primarily phenylethanoid glycosides (PhGs), while one compound, mussaenoside acide, was an iridoid polysaccharide. PhGs are the main active compounds in terms of treatment of kidney deficiency, and antioxidant and neuroprotective effects [36]

PCA of C. deserticola and C. tubulosa

PCA was employed to distinguish samples of different plant species. PCA is an unsupervised multivariate data analysis method that aims to visualize the similarities and/or differences within multivariate data of secondary metabolite composition [37]. The two-component PCA model cumulatively accounted for 46.04% of the variation (PC1, 36.43%; PC2, 9.61%). Figure 2 shows that 24 samples were clustered into two groups in the PCA scores plotted according to species origin, indicating that the chemical composition of C. deserticola and C. tubulosa differed significantly.

The main effective compound of cistanche: Echinacoside