Temporal Endurance Of Exercise-induced Benefits On Hippocampus-dependent Memory And Synaptic Plasticity in Female Mice Part 2

2.5. In vitro hippocampal slice preparation

Shortly following OLM acquisition, mice were anesthetized with isoflurane, decapitated, and the brains were quickly removed and submerged in ice-cold, oxygenated dissection medium containing (in mM): 124 NaCl, 3 KCl, 1.25 KH 2 PO 4, 5 MgSO 4, 0 CaCl 2, 26 NaHCO 3, and 10 glucose. 

We all know that glucose is the body’s main source of energy, but did you know that it helps improve memory?

Glucose is great for brain function because glucose is the brain's primary fuel. Our brains require a constant supply of energy to perform various complex tasks such as thinking, cognition, and memory. As our daily activities increase, the energy demands of the brain also increase, so we need to consume enough glucose to keep the brain functioning.

Additionally, studies show that glucose can enhance the brain's memory abilities. When performing memory tasks, the brain requires large amounts of glucose to support communication and information transmission between large numbers of neurons. If the supply of glucose is insufficient, the brain's memory function will be affected. Therefore, getting enough glucose is one of the keys to maintaining healthy brain function.

There are many sources of glucose, such as grains, fruits, vegetables, and high-quality carbohydrates. We only need to consume these foods reasonably in our daily diet to obtain enough glucose, thereby promoting healthy brain development.

In short, glucose is one of the important factors in maintaining brain health and can help us better record and recall information. Therefore, eating properly and consuming enough glucose is not only good for the body, but also extremely important for the brain. It can be seen that we need to improve our memory. Cistanche deserticola can significantly improve memory, because Cistanche deserticola can also regulate the balance of neurotransmitters, such as increasing the levels of acetylcholine and growth factors. These substances are very important for memory and learning. In addition, meat can also improve blood flow and promote oxygen delivery, which can ensure that the brain receives sufficient nutrients and energy, thus improving brain vitality and endurance.

Click know ways to improve brain function

Coronal hippocampal slices (340 μm) (n = 11 (0–0–0), 6 (14–0– 0), 10 (14–7–0), 8 (14–7–2) slices from 6, 3, 5 and 5 mice) were prepared using a Leica vibrating tissue slicer (Model: VT1000S) before being transferred to an interface recording containing preheated artificial cerebrospinal fluid (CSF) of the following composition (in mM): 124 NaCl, 3 KCl, 1.25, KH 2 PO 4, 1.5 MgSO 4, 2.5 CaCl 2, 26 NaHCO 3, and 10 glucose and maintained at 31 ± 10C. Slices were continuously perfused with this solution at a rate of 1.75–2 ml/min while the surface of the slices was exposed to warm, humidified 95% O2 / 5% CO2. Recordings began after at least 2 h of incubation.

Field excitatory postsynaptic potentials (fEPSPs) were recorded from CA1b stratum radiatum apical dendrites using a single glass pipette filled with 2 M NaCl (2–3 MΩ) in response to orthodromic stimulation (twisted nichrome wire, 65 μm diameter) of Schaffer collateral-commissural projections in CA1c stratum radiatum. Pulses were administered at 0.05 Hz using a current that elicited a 50% maximal spike-free response. After establishing a 10–20-minute stable baseline, long-term potentiation (LTP) was induced by delivering a single episode of 5 ‘theta’ bursts, each burst consisting of four pulses at 100 Hz and the bursts themselves separated by 200 ms (i.e., theta burst stimulation or TBS). The stimulation intensity was not increased during TBS.

The figures are presented as mean ± SEM. The fEPSP slope was measured at a 10–90% fall of the slope and data in figures on LTP were normalized to the last 20 min of baseline. Electrophysiological measures were analyzed using a one-way ANOVA unless otherwise specified in the text and the level of significance was set at p ≤ 0.05.

2.6. RT-qPCR

Dorsal hippocampus tissue was kept frozen at −80 °C until processing. RNA was isolated using RNeasy Mini Kits (Qiagen) according to the manufacturer’s instructions and total RNA (50 ng) was reverse transcribed. cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Roche Applied Science). Primers were designed using the Roche Universal Probe Library; all primers were obtained from IDT and probes from the Roche Universal Probe Library and were used for multiplexing in the Roche Light-Cycle 480 II Machine (Roche). 

For bdnf exon VI transcript and Hprt, we designed a PrimeTime qPCR assay (IDT) as no Universal Probe Library assay was available. The following primers were used: bdnf exon I: forward primer (5′–3′): GCATCTGTTGGGGAGACAAG, reverse primer (5′–3′): TCACCTGGTG-GAACATTGTG, probe 56, bdnf exon IV: forward primer (5′–3′): GCTGCCTTGATGTTTACTTTGA, reverse primer (5′–3′): AAGGATGGT-CATCACTCTTCTCA, probe 31, bdnf exon VI: forward primer (5′–3′): CTGGGAGGCTTTGATGAGAC, reverse primer (5′–3′ ): GCCTTCATG-CAACCGAAGTA, probe: /56-FAM/AGA CAG/Zen/ AAGCGTGA-CAACAAT/3IABkFQ/; bdnf exon IX: forward primer (5′– 3′): GCCTTTGGAGCCTCCTCTAC, reverse primer (5′–3′): AAGGATGGTCATCACTCTTCTCA, probe 31. All target probes were conjugated to the dye FAM. 

All values were normalized to Hprt expression, which used the following primers: forward primer (5′–3′): TGCTCGAGATGTCATGAAGG, reverse primer (5′–3′): CTTTTATGTCCCCCGTT-GAC, probe: /5HEX/AT CAC ATT G/Zen/T GGC CCT CTG T/3IABkFQ/. The normalization of values is adjusted to Hprt expression. Data and statistical analysis are done using Roche proprietary algorithms and REST 2009 software based on the Plaffl method (Pfaffl, 2001; Pfaffl et al., 2002).

2.7. Statistical analysis

Sample sizes in this study were similar to those generally used in the field, including those reported in previous publications (e.g. Butler et al., 2019; Keiser et al., 2021; Kwapis et al., 2018, 2020; López et al., 2019; Vogel-Ciernia et al., 2013) although no statistical methods were used to predetermine sample sizes. Statistical analyses were performed using either one-way ANOVA (Figs.1, 2D, 3B, 4, S1C–F, S2 C–F) or two-way ANOVA (Figs. 2A–C, S1A–B, S2 A–B) followed by Tukey- corrected t-tests to compare individual groups. Simple planned comparisons to assess discrimination index (DI) scores were conducted within the group to compare training and test DI using Student’s t-test (Fig. 1D). Two-way ANOVA had factors of Estrous Phase and Exercise Condition (Fig. 2A–B), Estrous Phase and Day (Fig. 2C) or Exercise Condition and Day (Fig. S1 A–B, S2 A–B). All statistics were performed with GraphPad Prism 8 software. The main effects and interactions for all ANOVA are described in the text. All analyses were two-tailed and required an α value of 0.05 for significance. Error bars in all figures represent SEM.

3. Results
3.1. Exercise enables long-term memory formation under subthreshold acquisition conditions in female mice

Previously we have demonstrated that 14d of exercise in male mice facilitates learning under subthreshold acquisition conditions of the OLM task which abolished following 7d of sedentary delay (Butler et al., 2019). Moreover, a subthreshold 2d of reactivating exercise after this sedentary delay period can re-engage the initial benefits of 14d exercise to induce the benefits on cognition. On a molecular level, exercise-induced hippocampal BDNF also diminishes significantly from 7 to 14d post-exercise and can be re-facilitated with a subsequent 2d bout of wheel running (Berchtold et al., 2005, Berchtold et al., 2010). Collectively, the exercise paradigm consisting of 14d of initial exercise, 7d of sedentary delay, and 2d of reactivating exercise appears to capture the temporal dynamic of exercise-induced benefits in males. 

That is, the initial exercise engages cognitive benefits, which even though becomes dormant when exercise ceases, can be reactivated by a subsequent low-level exercise. Therefore, we examine whether similar exercise parameters also engage and maintain the cognitive benefits of exercise in females. We ran female mice through different exercise regimens that consisted of an initial exercise (14d or 0d) followed by a sedentary delay (7d or 0d) and a reactivating exercise (2d or 0d) before OLM acquisition and test (Fig. 1A). 

To probe the beneficial effects of exercise on memory performance, mice received a 3-minute subthreshold acquisition session during which the distinct locations (A1 and A2) of two identical objects were learned. In male mice, this training duration has been demonstrated as a subthreshold for encoding in sedentary animals (Butler et al., 2019; Intlekofer et al., 2013; Malvaez et al., 2013; McQuown et al., 2011). On test day, one of the objects in the original locations was moved to a novel location (A3) and time spent exploring each object location was examined. Given that mice exhibit an innate preference for novelty, long-term OLM is evidenced by greater exploration of the novel object location compared to the object in the fixed location.

Exercise parameters affected memory performance on test day (Fig. 1D; one-way ANOVA, Group F (3,27) = 7.66, p = 0.0007), where 14 days of initial exercise (14–0–0) led to robust long-term memory performance relative to the sedentary control group (0–0–0) (Fig. 1D Tukey’s post hoc test, p = 0.003). A 7-day sedentary delay resulted in diminished performance relative to the 14–0–0 initial exercise group (Fig. 1D Tukey’s post hoc test, p = 0.007) and a non-significant difference from the control (0–0–0) (Fig. 1D Tukey’s post hoc test, p = 0.985). 

To investigate whether the benefits of the initial exercise are maintained throughout the sedentary delay, a group of animals was subjected to 2d of reactivating exercise before OLM acquisition following a sedentary delay (14–7–2). Mice in the reactivating exercise cohort (14–7–2) displayed significantly higher DI scores compared to both sedentary control (0–0–0) (Fig. 1D Tukey’s post hoc test, p = 0.019) and sedentary delay (14–7–0) cohorts (Fig. 1D Tukey’s post hoc test, p = 0.043). 

Within-group comparisons (Fig. 1D, significance denoted with # symbol within bars) of the DI scores from acquisition day compared to test day reveal greater DI scores during the test compared with training for only the 14–0–0 (t (12) = 8.449, p = 0.0001) and 14–7–2 groups (t (14) = 4.991, p = 0.0002), but not the 0–0–0 (t (14) = 1.871, p = 0.082) or 14–7–0 groups (t(14) = 1.844, p = 0.086), further confirming successful long-term OLM formation only in the initial exercise (14–0–0) and reactivating exercise (14–7–2) cohorts. Test performance was not influenced by differences in object exploration time on test day (Fig. 1E; one-way ANOVA: F (3,27) = 2.264, p = 0.1038). Importantly, each exercise group habituated to the experimental context, measured by a significant reduction in distance traveled and mean speed across habituation sessions (Supplementary Fig. S1 A–B; Tukey’s post hoc test habituation day 1 vs 6, p < 0.05 for 0–0–0, 14–7–0 and 14–7–2 groups; p = 0.07 for 14–0–0 group). 

During the acquisition session, mice in all groups exhibited relatively low and similar discrimination index (DI) scores, indicating a lack of preference for either object on training day in locations A1 and A2 (Fig. 1B; one-way ANOVA, DI: Group F (3,27) = 2.604, p = 0.0724). Overall object exploration was also similar between groups (Fig. 1C; one-way ANOVA, DI: Group F (3,27) = 1.243, p = 0.3137), indicating that object preference or differences in exploration do not contribute to observed differences in test performance. Together, these data demonstrate that 14d of an initial exercise enhances object-location memory formation under subthreshold acquisition conditions in female mice. This effect is maintained throughout the sedentary delay period and benefits can be re-engaged with a 2d reactivating exercise session.

3.2. Estrous phase affects voluntary wheel-running activity but not OLM performance

The estrous cycle of female rodents typically spans 4–5 days, during which reproductive hormones naturally fluctuate (Becker et al., 2017; Becker & Koob, 2016). Indeed, wheel running activity varies throughout the estrous cycle, suggesting the role of circulating sex hormones in modulating the physical activity of female rodents (Novak et al., 2012; Sherwin, 1998). Thus, we compare running distance across different phases of the estrous cycle to assess the role of the estrous cycle on wheel-running behavior. 

Regarding learning and memory, while some studies report no effect of estrous phase on behavioral performance of spatial memory tasks (Berry et al., 1997; Ter Horst et al., 2013; Keiser et al., 2017), others have suggested otherwise (Cordeira et al., 2018; Hokenson et al., 2021; Milad et al., 2009; Pompili et al., 2010; Tuscher et al., 2015; Warren & Juraska, 1997; Trask et al., 2020), including enhanced performance of the OLM task during proestrus and estrus phase (Frick & Berger-Sweeney, 2001; Frye et al., 2007; Paris & Frye, 2008; Pompili et al., 2010). 

Hence, we also compare OLM performance between estrous stages during acquisition and test days to identify any effects of estrous cycle on OLM performance within the group. Due to the low sample size, mice in the proestrus and estrus phases were grouped and mice in metestrus and diestrus were placed in another grouping in the analysis of estrus on acquisition and retrieval. In an analysis of running distance, daily running was graphed with estrous phases collapsed due to low sample size and analyzed with all phases separated when assessing mean running distance over the initial 14-day period.

An effect of estrous on running distance was not observed in assessments of daily running (Fig. 2A; two-way ANOVA, Phase F (1,63) = 0.10, p = 0.748; Phase × Day F (13,424) = 0.66, p = 0.798), but an effect of estrous phase was observed when estrous phases were separated and mean running distance was assessed (Fig. 2B; one-way ANOVA, Phase F (3,511) = 2.88, p = 0.035), where females in estrus ran significantly more than females in the diestrus (Fig. Tukey’s post hoc test, p = 0.034), but not proestrus (p = 0.133) or metestrus (p = 0.949) phases. 

Estrous phase on training (Fig. 2C; two-way ANOVA, Phase F (1,23) = 0.11, p = 0.738; Phase × Exercise Group F (3,23) = 0.70, p = 0.559) or test day (Fig. 2D; two-way ANOVA, Phase F (1,23) = 1.79, p = 0.193; Phase × Exercise Group F (3,23) = 0.20, p = 0.894) did not affect performance. Together, our data indicate that in line with other reports on estrous and running distance, mice in estrus result in greater overall running distance.

3.3. Exercise-enhanced hippocampal LTP is maintained throughout inactivity

As shown above, our exercise paradigms facilitate long-term OLM following 14d of exercise and 2d of reactivating exercise. Hence, we asked whether hippocampal synaptic plasticity was also enhanced following exercise-facilitated learning in these same animals (Fig. 1A). Acute hippocampal slices were collected and processed to measure field excitatory postsynaptic potentials (fEPSP) recordings from the stratum radiatum of the CA1b in response to stimulation of Schaffer collateral-commissural projections in CA1c stratum radiatum. 

To examine changes in synaptic plasticity post-learning, we applied a single train of 5 theta-burst stimulation (TBS) to induce long-term potentiation (LTP) in slices collected during the memory consolidation window, 1 h after OLM acquisition. This BDNFdependent form of stimulation has been previously reported to induce stable potentiation in mice (Acharya et al., 2019; Keiser et al., 2021; Kramár et al., 2004; Kwapis et al., 2018; Vogel-Ciernia et al., 2013; White et al., 2016). Twenty minutes post-TBS, the fEPSP slope begins to stabilize as LTP enters the consolidation phase, during which dynamic synaptic events occur to maintain long-term synaptic strength (G. Lynch, 1998). 

In slices prepared from all mice, TBS produced immediate robust potentiation which decayed and then stabilized over the following 20 min (Fig. 3A). Stable LTP, measured 50–60 min post-TBS, was observed in exercise conditions (Fig. 3B; one-way ANOVA F (3,31) = 9.32, p = 0.0002) where all groups that underwent exercise displayed an increase in mean potentiation relative to sedentary control (14–0–0: p = 0.003, 14–7–0: p = 0.0002, 14–7– 2: p = 0.033), indicating enhanced synaptic plasticity. To examine whether this synaptic strengthening was due to changes in baseline neuronal function within the hippocampus, we generated input/output curves and measured changes in paired-pulse facilitation. 

There was no significant difference between groups in the slope of the curves for fEPSP slope responses relative to fiber volley magnitude (Fig. 3C; one-way ANOVA F (3,31) = 0.35, p = 0.79) or paired-pulse facilitation (Fig. 3D; two-way ANOVA, group: F (3,31) = 1.49, p = 0.24, interaction: F (6,62) 1.70, p = 0.13). Together, these data suggest that an initial exercise period enhances hippocampal synaptic plasticity that persists even after exercise cessation and following a reactivating exercise session without altering baseline neuronal functions. It is worth noting that this long-lasting enhancement of hippocampal LTP is inconsistent with diminished OLM performance observed following the sedentary delay, which we address in the discussion.

For more information:1950477648nn@gmail.com