The Current Status Of Neuroprotection in Congenital Heart Disease Part 1
Mar 07, 2024
Abstract:
The presence of ectopic DNA in the cytoplasm induces inflammation and cell death. It has been widely reported that leakage of nuclear DNA into the cytoplasm can mainly be sensed by cyclic GMP-AMP synthase (cGAS).
DNA is the molecule that specifies each person's genetic information and is found in every one of our cells. Recent research shows that DNA can leak into the cytoplasm through certain pathways and affect our memory.
This phenomenon is common in older adults and people with cognitive impairment. When DNA leaks into the cytoplasm, it interferes with normal functions within the cell and increases the risk of memory loss and cognitive impairment.
However, we don't have to feel depressed and hopeless about this. There are many ways to improve memory and cognitive abilities to help us maintain a healthy brain.
First, you must maintain a healthy lifestyle. This includes eating a balanced diet, getting enough sleep, getting moderate exercise, and reducing stress. These practices promote brain health, thereby avoiding DNA leakage and improving memory.
Secondly, cognitive training is required. This can include playing math games, reading, learning new skills, etc. These activities can help stimulate the brain and promote neurogenesis to avoid DNA leakage.
Finally, keep a positive attitude. Emotional instability and excessive stress can cause changes in brain chemistry that promote DNA leakage. Therefore, we need to learn to face the challenges in life positively and maintain an optimistic attitude.
In summary, although DNA leakage into the cytoplasm may affect memory, we can improve brain health, avoid DNA leakage, and ultimately improve our memory by adopting the right lifestyle, engaging in cognitive training, and maintaining a positive mindset. Memory and cognitive abilities. It can be seen that we need to improve memory, and Cistanche deserticola can significantly improve memory because Cistanche deserticola is a traditional Chinese medicinal material that has many unique effects, one of which is to improve memory. The efficacy of Cistanche deserticola comes from the multiple active ingredients it contains, including tannic acid, polysaccharides, flavonoid glycosides, etc. These ingredients can promote brain health through a variety of pathways.

Click know 10 ways to improve memory
We recently reported that mitochondria-derived cytoplasmic double-stranded DNA (dsDNA) that has escaped lysosomal degradation induces significant cytotoxicity in cultured cells and in vivo. Cytoplasmic mitochondrial DNA is assumed to be involved in various diseases and disorders, and more and more papers have been published confirming this. On the other hand, the current method for evaluating mitochondrial DNA in the cytoplasm may not be quantitative.
Here, we introduce in detail a method to evaluate ectopic mitochondrial DNA in cells. This method is useful in basic research as well as in the study of aging, Parkinson's disease, Alzheimer's disease, heart failure, autoimmune diseases, cancer, and other conditions.
Keywords: ectopic DNA; mitochondrial DNA; mitochondrial transcription factor A (TFAM); Parkinson's disease.
1. Introduction
DNA contains important information for survival and inheritance, and it needs to be protected from various stressors, including oxidants and mutagens. Eukaryotic cells contain mitochondria, which produce energy, together with a lot of active oxygen species, through aerobic respiration.
Thus, in the eukaryotic cell, DNA exists in the nucleus or mitochondria, packed inside the nuclear membrane or mitochondrial membrane, respectively. However, DNA can be present in the cytoplasm under certain conditions, such as during viral or non-viral infections [1–4].
Even in some non-infectious conditions (for example, aging or various age-related disorders or cancer), DNA may be leaked into the cytoplasm from the nucleus or mitochondria [5–7].
DNA in the cytoplasm can be inflammatory and toxic to cells. It has been widely reported that leakage of nuclear DNA into the cytoplasm induces inflammation, cytotoxicity, and senescence-associated secretory phenotype (SASP), mainly via the cyclic GMP-AMP synthase (cGAS)-stimulator of the interferon genes (STING) pathway [5,6].
We recently reported that cytosolic double-stranded DNA (dsDNA) of mitochondrial origin escaping from lysosomal degradation was shown to induce cytotoxicity and neurodegeneration in cellular models of Parkinson's disease [8]. The presence or increase in such ectopic DNA was often indicated by representative microscopic images and circumstantial evidence, not by the increase in DNA leakage itself.

It is expected that the evaluation of this ectopic DNA will become more and more important, not only for basic research but also for research on aging and other diseases, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, heart failure, autoimmune diseases, diabetes, non-alcoholic steatohepatitis (NASH), and cancers. The cGAS–STING pathway has been reported to be crucial not only in aging but also in the pathogenesis of these diseases [8–17].
Probably due to the oxidative circumstances around the mitochondria and the lack of an efficient DNA-repair system for mitochondrial DNA, mitochondrial DNA is much more susceptible to mutation or damage than nuclear DNA [18,19].
Unlike nuclear DNA, mitochondrial DNA exists in multiple copies in a single cell and is synthesized as needed. Therefore, mitochondrial DNA might have a much greater chance of being leaked into the cytoplasm during aging or in malignant conditions such as age-related disorders, mitochondrial dysfunction, or cancers.
Detection and measurement of such cytoplasmic mitochondrial DNA could be important in understanding the pathogenesis of various diseases and aging and could become a biomarker and a therapeutic target.
We developed a semi-quantitative method to evaluate ectopic mitochondrial DNA leaking into the cytoplasm, and here we describe the method in detail. This paper enables objective evaluation of mitochondrial DNA leakage and is useful in the study of various disease pathologies.
2. Materials and Methods
2.1. Cell Lines, siRNA Treatment, and Quantitative PCR (qPCR) Analysis
HeLa cells were derived from cervical cancer cells from a female patient (ATCC, CCL-2). HeLa cells were cultured at 37 ◦C under 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM) (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum (FBS) (Biowest, Nuaillé, France) and a penicillin–streptomycin solution (100 units/mL penicillin G and 100 µg/mL streptomycin sulfate, Wako, Osaka, Japan).
One day before transfection, HeLa cells were plated at a density of 600 cells/µL. The expression of genes of interest was silenced in HeLa cells using Stealth RNAi siRNA (mitochondrial transcription factor A, TFAM: HSS144251, glucocerebrosidase, GBA: HSS178140, Thermo Fisher Scientific, Waltham, MA, USA) in Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions (a final RNA concentration of 10 nM).
Three days after siRNA knockdown, total cellular RNA was isolated using TRIzol reagent according to the manufacturer's instructions (Thermo Fisher Scientific). The cDNA templates were synthesized from the purified RNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) with oligo (dT)20 primers. qPCR was performed using TB Green Premix Ex Taq II (Takara Bio, Kusatsu, Japan) and analyzed in a Thermal Cycler Dice Real Time System Lite (Takara Bio). The PCR primers used in the present study were GBA forward (TGCTGCTCTCAACATCCTTGCC), GBA reverse (TAGGTGCGGATGGAGAAGTCAC), TFAM forward (GGCAAGTTGTCCAAAGAAACC), TFAM reverse (GCATCTGGGTTCTGAGCTTTA), Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) forward (CAGCCTCAAGATCATCAGCA), and GAPDH reverse (TGTGGTCATGAGTCCTTCCA).
Statistical analyses were performed using GraphPad Prism software version 9.3.1 (GraphPad Software, San Diego, CA, USA). Two-sided Student's t-tests were used to compare arithmetic means between two groups. Data are presented as the means and ± standard errors of the means.
2.2. Immunofluorescence Detection of Ectopic Mitochondrial DNA and Image Analysis
One day before transfection, HeLa cells were plated at a density of 600 cells/µL. The expression of genes of interest was silenced in HeLa cells using Stealth RNAi siRNA (Thermo Fisher Scientific) in Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions (a final RNA concentration of 10 nM).

Three days after siRNA knockdown, cells were subjected to immunofluorescence staining. For the detection of mitochondrial DNA, anti-dsDNA antibody (Abcam, Cambridge, UK, clone 35I9, Cat# ab27156, RRID: AB_470907 or EMD Millipore, Billerica, MA, USA, clone AC-30-10, Cat# CBL186, RRID: AB_11213573) showed a better signal-to-noise ratio than Hoechst 33258, DAPI, or Picogreen. Here we combined three primary antibodies: anti-dsDNA antibody (35I9 DNA) (Abcam, Cat# ab27156, RRID: AB_470907), anti-histone-H2B antibody (Abcam, Cat# ab134211), and anti-heat-shock-protein-60 (Hsp60) antibody (Abcam, Cat# ab46798, RRID: AB_881444).
Other antibodies can be chosen or fluorescently tagged with histone, or Hsp60 can be used alternatively, but it is necessary to optimize the conditions of triple staining for each combination.
Cells were washed twice with phosphate-buffered saline (PBS) and fixed with ice-cold methanol for 10 min at 4 ◦C. Alternatively, 4% paraformaldehyde (PFA) can be used for fixation, but the background signals seem much greater in PFA-fixed samples. After fixation, the cells were washed three times with phosphate-buffered saline with Tween 20 (PBST) for 5 min each. Cells were permeabilized with PBS containing 0.2% (w/v) Triton X-100 for 10 min.
After being washed three times with PBST for 5 min each time, cells were incubated with 2% (w/v) bovine serum albumin (BSA) in PBST for 30 min. The cells were incubated with a single primary antibody, anti-histone-H2B antibody (1/400, Abcam, Cat# ab134211) diluted in 2% (w/v) BSA in PBST O/N at 4 ◦C. After being washed three times with PBST for 5 min each time, cells were incubated with an Alexa Fluor 488-AffiniPure Donkey anti-Chicken IgY (IgG) (H+L) (1/200, Wako, Cat# 563-78311) diluted in 2% (w/v) BSA in PBST for 1 hr at room temperature (RT).
After being washed three times for 5 min each time with PBST, cells were incubated with primary antibodies, and anti-dsDNA antibody (35I9 DNA) (1/800, Abcam, Cat# ab27156, RRID: AB_470907) and anti-Hsp60 antibody (1/400, Abcam, Cat# ab46798, RRID: AB_881444) diluted in 2% (w/v) BSA in PBST were applied for 1 hr at RT or overnight (O/N) at 4◦C.
After being washed three times with PBST for 5 min each time, cells were incubated with highly cross-adsorbed Alexa Fluor 680-conjugated Donkey anti-Rabbit IgG (H+L) (1/200, Thermo Fisher Scientific, Cat# A10043, RRID: AB_2534018) and Donkey anti-Mouse IgG H&L (Alexa Fluor® 594) (1/200, Abcam Cat# ab150108, RRID: AB_2732073) diluted in 2% (w/v) BSA in PBST for 1 hr at RT.

The cells were washed three times with PBST for 5 min each time, and the specimen was analyzed using an A1R+ confocal microscope (Nikon, Tokyo, Japan).
For more information:1950477648nn@gmail.com






