Part 1:Effect Of Acteoside As A Cell Protector To Produce A Cloned Dog

Ji Hye Lee1☯, Ju Lan Chun1☯, Keun Jung Kim1, Eun Young Kim1, Dong-hee Kim1, Bo Myeong Lee1, Kil Woo Han1, Kang-Sun Park1, Kyung-Bon Lee2, Min Kyu Kim1*

1 Division of Animal & Dairy Science, College of Agriculture and Life Science, Chungnam National University, Daejeon, Republic of Korea,

2 Department of Biology Education, College of Education, Chonnam National University, Gwangju, Republic of Korea

Contact: joanna.jia@wecistanche.com

Pls click here to Part 2

Abstract

Somatic cell nuclear transfer (SCNT) is a well-known laboratory technique. The principle of the SCNT involves reprogramming a somatic nucleus by injecting a somatic cell into a recipient oocyte whose nucleus has been removed. Therefore, the nucleus donor cells are considered as a crucial factor in SCNT. Cell cycle synchronization of nucleus donor cells at the G0/G1 stage can be induced by contact inhibition or serum starvation. In this study, acteoside, a phenylpropanoid glycoside compound, was investigated to determine whether it is applicable for inducing cell cycle synchronization, cytoprotection, and improving SCNT efficiency in canine fetal fibroblasts. Primary canine fetal fibroblasts were treated with acteoside (10, 30, 50 μM) for various time periods (24, 48, and 72 hours). Cell cycle synchronization at G0/G1 stage did not differ significantly with the method of induction: acteoside treatment, contact inhibition, or serum starvation. However, of these three treatments, serum starvation resulted in a significantly increased level of reactive oxygen species (ROS) (99.5 ± 0.3%) and apoptosis. The results also revealed that acteoside reduced ROS and apoptosis processes including necrosis in canine fetal fibroblasts, and improved cell survival. Canine fetal fibroblasts treated with acteoside were successfully arrested at the G0/G1 stage. Moreover, the reconstructed embryos using nucleus donor cells treated with acteoside produced a healthy cloned dog, but not the embryos produced using nucleus donor cells subjected to contact inhibition. In conclusion, acteoside induced cell cycle synchronization of nucleus donor cells would be an alternative method to improve the efficiency of canine SCNT because of its cytoprotective effects.

Cistanche acteoside Can Enhance Immunity

Introduction

SCNT technique has been used to produce genetically superior or manipulated animals for agricultural purposes and as biomedical resources. With the increasing need for animal models of disease, rescuing animals in danger of extinction, stem cells for regenerative medicine, organ transplantation, etc., the interest in cloning animals using SCNT has been increasing in recent times [1–5]. Even though the production of cloned animals has been successful, the efficiency of SCNT is still very low [6]. The causes of the low SCNT embryo developmental competence include many factors which are related to the quality of recipient oocytes, the quality of the nucleus donor cells, and the condition of the surrogate mother [7–10].

Reactive oxygen species (ROS) and apoptosis have been known to be involved in female reproductive processes including oocyte development in vivo and in vitro [11–14]. ROS interrupt embryo development by inducing cytoplasmic condensation, DNA damage, and apoptosis in embryos. Supporting studies have reported that reducing ROS improves SCNT embryo development competence during in vitro culture [15–17]. Apoptosis is a physiological process that occurs spontaneously during normal preimplantation embryo development to maintain cellular homeostasis by removing DNA damaged/malfunctioning cells. ROS causes DNA fragmentation and increases apoptotic blastomeres that disturb embryo development. The event of ROS and apoptosis is observed more often after SCNT than after in vitro fertilization [18, 19]. Many studies reported that SCNT embryo development competence is rescued by reducing the levels of ROS and apoptosis by using antioxidants such as selenium [20], insulin-transferrin-selenium [17, 21], melatonin [22], and glutathione [23].

Previous studies reported that the use of donor cells arrested at the G0/G1 stage improved the efficiency of SCNT [7, 9, 24–28]. The chromatin in the donor cells at G0/G1 stage has been considered the most effective for SCNT embryo development competency. To synchronize the donor cell cycle, contact inhibition, serum starvation, and chemical treatments have been frequently used [7, 25, 29, 30]. However, serum starvation reduced cell survival and increases DNA fragmentation, which leads to apoptosis [31]. Chemical inhibition is another strategy to arrest the cell cycle at the G0/G1 stage using inhibitors such as roscovitine [29, 32], dimethyl sulfoxide (DMSO) [33], and cycloheximide (CHX) [34]. The efficiency of the method used for synchronization is affected by the types and species of the donor cells. For optimal donor cell synchronization, various aspects of the methods used need to be carefully evaluated.

Acteoside (also known as verbascoside) [2-(3, 4-dihydroxy phenyl ethyl)-1-O-a-L-rhamnopyranosyl-(1 / 3)-b-D-(4-O-caffeoyl)-glucopyranoside] is isolated from the violet flowers of Syringa vulgaris. Plants containing acteoside have been known to have anti-microbial and anti-fungal activities [35–37], and prevent inflammation. Indeed, acteoside exhibits various biological activities in vitro and in vivo such as anti-oxidative activity, anti-apoptotic activity, cytotoxicity against various tumor cells, and cell cycle synchronization at the G0/G1 stage as a cyclin-dependent kinase (CDK) inhibitor [38]. For example Lee et al.[38] reported that acteoside treatment can inhibit the proliferation of human promyelocytic HL-60 leukemia cells by inducing the cell cycle arrest at the G0/G1 stage. However, the effect of acteoside-treated donor cells on the efficiency of canine SCNT has yet to be studied.

In this study, the effects of acteoside on the cell cycle synchronization, ROS, and apoptosis on canine fetal fibroblasts were investigated. The analysis of cell cycle synchronization, ROS, and apoptosis was performed using fluorescence-activated cell sorting (FACS). To demonstrate the efficiency of the donor cells treated with the acteoside, SCNT embryos were cultured and transferred into a recipient dog, and successfully produced a healthy cloned dog.

cistanche can treat kidney disease improve renal function

Materials and Methods

Ethics statement

In this study, 44 female mongrel dogs (aged 1–6 years) were used as oocyte donors and embryo transfer surrogates, and a female beagle (aged 2 years) was used for the establishment of fetal fibroblast cell lines. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Chungnam National University (Approval Number: CNU-00487) and performed according to “The Guide for the Care and Use of Laboratory Animals” published by IACUC of Chungnam National University. Dogs were raised indoors in separate cages with a temperature and ventilation control system. Dogs were fed a commercial diet once daily and provided water ad libitum. In all the animal experiments, dogs were anesthetized with 6 mg/kg ketamine and xylazine initially and maintained in anesthetized condition with 2% isoflurane. At the end of the surgery, antibiotics (Procaine Penicillin G, Benzathine Penicillin G, and Dihydrostreptomycin sulfate) were administrated to prevent any infection. After surgery, the dogs were transferred to their own individual cages with freshwater, monitored, and provided special care from the veterinarian in charge, so that necessary treatments could be administered if the animals needed it.

Chemicals

All chemicals were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA) unless otherwise stated. Acteoside was obtained from Chengdu Biopurify Phytochemicals Ltd. in China.

Isolation of canine fetal fibroblasts

Canine fetal fibroblasts were obtained from 28-day old fetuses. Briefly, a female beagle was artificially inseminated with the sperm of a male beagle. After 28 days, pregnancy in the female beagle was confirmed and 5 fetuses were obtained by celiohysterectomy. Fetuses were washed thrice in phosphate-buffered saline (PBS; Gibco, Thermo Fisher Scientific Inc., Waltham, Massachu- setts, USA). The head, internal organs, and limbs of the fetuses were removed with a surgical blade and the remaining body parts were minced in PBS. Pieces of fetuses were washed twice by centrifugation at 400 × for 5 min and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco) supplemented with 1% penicillin-streptomycin (product No. P4458) and 20% fetal bovine serum (FBS; Gibco) at 39°C in a humidified atmosphere of 5% CO2 and 95% air. When cells reached confluence after 5–7 days, they were treated with 0.25% trypsin-EDTA (Gibco) for 2 min and harvested. Two canine fetal fibroblast cell lines were established from two individual fetuses. The cells were frozen in 10% DMSO in FBS and stored in liquid nitrogen at -196°C until they were used.

Cell treatment

The frozen canine fibroblasts were thawed and cultured until 80% confluency. Cells were harvested and passaged 4 to 7 times for subsequent experiments. Cells were seeded at a concentration of 106/mL in 60 mm culture dishes. The cells were cultured in (1) DMEM supplemented with 10% FBS and 1% penicillin-streptomycin for five days (contact inhibition), (2) DMEM supplemented with 0.5% FBS and 1% penicillin-streptomycin for five days (serum starvation), or (3) DMEM supplemented with 10% FBS and 1% penicillin-streptomycin containing acteoside at 10 μM, 30 μM, or 50 μM for 24 h, 48 h, and 72 h (acteoside treatment).

Cell cycle analysis by flow cytometry

For analysis of the cell cycle stages, cells were harvested using 0.25% trypsin-EDTA and washed 3 times with PBS by centrifugation. After the last wash, the supernatants were discarded and the cells resuspended in 0.3 mL PBS. For fixation, 0.7 mL cold absolute ethanol was added drop-wise to the cell suspension, mixed by gentle vortexing, and stored overnight at 4°C. The fixed cells were centrifuged and washed twice with cold PBS. The cells were resuspended in 0.25 mL PBS supplemented with 5 μL of 10 mg/mL RNase and incubated for 1 h at 37°C. Then,10 μL of 1 mg/mL propidium iodide (PI) was added. Cell cycle was analyzed by quantitation of DNA content in cell populations at G0/G1 (2n), S (between 2n and 4n), and G2/M (4n) phases using a FACS Calibur flow cytometer (Becton Dickinson, San Jose, CA, USA).

ROS detection by flow cytometry

ROS in live cells was assessed using an Image-iT™ Live Green Reactive Oxygen Species Detection Kit (Molecular Probes, Eugene, OR, USA). Briefly, cells were washed in PBS after removing the culture medium, and 2 mL of the 100 μM tert-butyl hydroperoxide (TBHP) working solution was added. After incubation at 37°C for 1 h, the TBHP working solution was removed, and the cells were gently washed 3 times in warm Dulbecco’s phosphate-buffered saline (DPBS; Gibco). Cells were then incubated in 25 μM 5-(and-6)-carboxy-2,7–dichlorodihydro- fluorescein diacetate (carboxy-H2DCFDA) working solution at 37°C for 30 min in the dark. When oxidized, carboxy-H2DCFDA emits green fluorescence, facilitating the assessment of ROS by flow cytometry. TBHP, which is an inducer of ROS production, was used as a positive control. The nuclei of the cells were stained with Hoechst 33342. After washing 3 times with PBS, cells were harvested by trypsinization, suspended in PBS, and used for detecting ROS by using a FACS Calibur flow cytometer (Becton Dickinson, San Jose, CA, USA). The rate of ROS formation was calculated by dividing the number of ROS positive cells by the total cell number and converting the values into percentages.

Apoptosis analysis by flow cytometry

Apoptosis analysis was performed using a Vybran1 Apoptosis Assay Kit #2 (Molecular Probes, Eugene, OR, USA). Briefly, the cells were harvested by trypsinization and washed 2 times with cold PBS. Thereafter, 100 μL of 1× annexin-binding buffer, 5 μL of Alexa Fluor 488 annexin V, and 1 μL of PI were added to the cells. After incubation for 15 min at room temperature, 400 μL of 1× annexin-binding buffer was added and the cell suspension was gently mixed. Annexin V, which is a Ca2+ -dependent phospholipid-binding protein has a high affinity for phosphatidylserine (PS). In live cells, PS is located on the inner cytoplasmic membrane and translocated to the outer cytoplasmic membrane in apoptotic cells. Apoptotic cells are distinguished by Annexin V labeled with Alexa Fluor 488 binding to PS on the outer membrane. In addition, PI, which is a nucleic acid binding dye, stains necrotic cells with red fluorescence. Therefore, apoptotic cells with green fluorescence, necrotic cells with red fluorescence, and live cells with little or no fluorescence in the cells were analyzed using a FACS Calibur flow cytometer (Becton Dickinson, San Jose, CA, USA). The rates were calculated by dividing the cell numbers of live, necrotic, or apoptotic cells with the total cell number, and converting the calculated values into percentages.

Collection of in vivo matured oocytes

To detect ovulation in each dog, serum progesterone (P4) concentration was measured using a DSL-3900ACTIVE progesterone Coated-tube Radioimmunoassay Kit (Diagnostic Systems Laboratories, Inc., TX, USA). As previously described [39, 40], the day when P4 concentration exceeded 4 ng/mL was considered as the day of ovulation. At 72 h after ovulation, oocytes were retrieved by laparotomy using aseptic surgical procedures. The fimbria of the oviduct was approached through the bursal slit and cannulated using an inverted flanged bulb steel needle (18 gauge, 7.5 cm). A 24 gauge intravenous (IV) catheter (Angiocath™ Plus, Becton Dickison Korea Inc., Seoul, Korea) was inserted into the isthmus of the oviduct near the uterotubal junction, and medium 199 (Gibco) supplemented with 1% penicillin-streptomycin and 5% FBS was introduced into the oviduct through the IV catheter. Oocytes were immediately transported to the laboratory. A total of 316 oocytes were collected from 31 dogs.

Somatic cell nuclear transfer and embryo transfer SCNT were performed as previously described [39]. Briefly, to remove cumulus cells from in vivo matured oocytes, cumulus-oocyte-complexes (COC) were repetitively pipetted in 0.1% hyaluronidase. The first polar body and metaphase-II chromosomes were removed by aspiration. Enucleation was confirmed by staining with Hoechst 33342 (bisbenzimide). Canine fetal fibroblasts were treated with 30 μM acteoside for 48 h and then harvested with 0.25% trypsin- EDTA. A single cell, which has a smooth cell membrane, was transferred into the perivitelline space of each enucleated oocyte. The couplets were equilibrated infusion medium, which is 0.26 M mannitol medium containing 0.1 mM HEPES, 0.5 mM MgSO4, and 0.05% BSA, and fused by two pulses of direct current (69–75 V for 15 μs) from an Electro-Cell Fusion apparatus (NEPA gene Co., Chiba, Japan). These couplets were incubated in medium 199 supplemented with 10% FBS for 1 h 30 min. The fused SCNT embryos were checked and chemical activation was induced by incubating them in 10 μM calcium ionophore (product No. C7522, Sigma) for 4 min. SCNT embryos were washed and then placed in a modified synthetic oviductal fluid medium (mSOF) [41] containing 1.9 mM 6-dimethylaminopurine (6-DMAP) for 3 h 30 min. The engineered embryos were surgically transferred into the oviducts of oestrus-synchronized surrogates within 4 h after SCNT. Pregnancy was confirmed by ultrasonography at 26 days (at the earliest) after embryo transfer.

active ingredient acteoside in cistanche

In vitro culture of cloned embryos

After SCNT, cloned embryos were cultured in 40 μL micro drops of a modified synthetic oviductal fluid medium (mSOF) (10 cloned embryos per microdrop) overlaid with mineral oil at 38.5°C in 5% CO2 and 95% air. SCNT embryo development was observed from day 2 to day 8.

Microsatellite and mitochondrial DNA analysis of a cloned dog

Total DNA was extracted from the nuclear donor cells, and the skin of the oocyte donor dogs, surrogate dogs, and the cloned dog by the G-spin™ Genomic DNA Extraction Kit (iNtRON BIOTECHNOLOGY, Seongnam, Korea) according to the manufacturer’s guidelines, and then was eluted in 100 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The amount of DNA was measured by the BioSpec-nano Spectrophotometer (Shimadzu Corp., Japan).

For microsatellite genotyping, the following 7 specific genes were selected: PEZ1, PEZ3, PEZ8, PEZ12, FH2010, FH2054, and FH2079. PCR was performed with initial denaturation for 10 min at 95°C, 20 cycles comprised of denaturation for 30 sec at 95°C, 30 sec of annealing at 58°C (-0.1°C/cycle), 1 min of extension at 72°C, and 15 more cycles comprised of denaturation for 30 sec at 95°C, 30 sec of annealing at 56°C, 1 min of extension at 72°C, and final extension at 72°C for 10 min.

For mitochondrial DNA sequencing, using the complete nucleotide sequences of canine mtDNA (GenBank accession no.: U96639), the following oligonucleotide primers were synthesized: Cytochrome b region (L14,252 –L14,631) F: ACTCATTCATTGACCTCCCAGCG,R: AGTTCCGATATAAGGGATGGCAGAG; Cytochrome c oxidase subunit II (L7,054—L7,465) F: ATGGCGTACCCATTTCAACT,R: GGATGGTTATTTCTATTGG; 16S rRNA (L2,033 –L2,472) F: GCAAAGGTAGCATAATCAT,R: AGGACTTTAATCGTTGAAC; D-loop region (L15,622 – L16,030) F: CATAGGACATATTAACTCAATC,R: AAGTCCAGCTACAAGTTATTTG [42]. The PCR cycles for this analysis included: 95°C initial denaturations for 5 min, 5 cycles of denaturation for 30 sec at 95°C, 40 sec of annealing at 60°C (-1°C/cycle), 1 min of extension at 72°C, and the next 30 cycles of denaturation for 30 sec at 95°C, 40 sec of annealing at 55°C, 1 min of extension at 72°C, and final extension at 72°C for 10 min. PCR fragments from the various experiments were analyzed using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems Inc., USA). Sequence assembly, multiple alignments, and alignment trimming for control regions were performed with the BioEdit software (v.7.0.5.3).

acteoside in cistanche can boost immune system